thesis statement for major depressive disorder

10 New Thesis Statement about Depression & Anxiety | How to Write One?

Did you know according to the National Institute of Mental Health; it is estimated that approximately 8.4% of adults are patients of major depression in the US? Well, depression is a common illness globally that affects a lot of people. Yet, the reasons for this psychological sickness vary from person to person and numerous studies are being conducted to discover more about depression.

Therefore, college and university students are currently assigned to write research papers, dissertations, essays, and a thesis about depression. However, writing essays on such topics aims to increase the awareness of physical and mental well-being among youth and help them find solutions.

However, a lot of students find it pretty challenging to write a thesis statement about depression and seek someone to write my essay . No worries! In this article, you will learn about what is a good thesis statement about mental health and some effective methods and approaches to write a killer headline and compose an astonishing essay about depression.

5 Thesis Statement About Depression:

• “The complexity of depression, which includes biological, psychological, and environmental components, emphasizes the need for individualized treatment plans that consider each person’s particular requirements.”
• “Depression in the workplace not only affects an individual’s productivity but also carries economic implications, emphasizing the importance of fostering a mental health-friendly work environment.”
• “Alternative, holistic approaches to mental health care have the potential to be more successful as the link between creative expressions, such as art therapy, and depression management becomes more commonly recognized.”
• “It is critical to enhance geriatric mental health treatment and reduce the stigma associated with mental illness in older people since depression in senior populations is typically underdiagnosed and mistreated.”
• “The link between early childhood adversity and the risk of developing depression later in life accentuates the importance of early intervention and support systems for children exposed to adverse experiences.”

5 Thesis Statements about Anxiety & Depression :

• “Depression and anxiety Co-occurring disorders are a major concern in mental health, necessitating integrated treatment options that meet the unique challenges that co-occurring diseases provide.”
• “The utilization of technology-driven therapies, such as smartphone apps and telehealth services, is a realistic approach of addressing persons suffering from anxiety and depression, while also increasing access to mental health care.”
• “The examination of the gut-brain connection and its potential role in anxiety and depression showcases a burgeoning area of research that could lead to novel treatments emphasizing nutrition and gut health.”
• “Adolescents who experience both anxiety and depression face a serious issue that calls for comprehensive school-based mental health programs and preventative measures to promote young people’s mental health.”
• “Exploring the impact of sociocultural factors and the role of community support systems in the experience of anxiety and depression provides insights into the development of culturally sensitive mental health interventions.”

GET ACADEMIC WRITING HELP

Your assignment won’t be delivered on time: you’ll get it beforehand. Review your work immediately and ask for free revisions right away. Get extensive help in:

• Online Class
• Essay Writing

Follow 7 Proven Methods to Compose Thesis Statement about Depression

A thesis is the overview of the concepts and ideas that you will write in your research paper or in the essay. Yet, a thesis statement about anxiety focuses more on the stress and depression topics for the paper you’re working on, which can be written by following the tips given below.

Nonetheless, you can compose an outline by covering the points mentioned below:

1. Pick a good study topic and perform a basic reading. Look for some intriguing statistics and try to come up with creative ways to approach your subject. Examine a few articles for deficiencies in understanding.

2. Make a list of your references and jot down when you come across a noteworthy quotation. You can cite them in your paper as references. Organize all of the information you’ve acquired in one location.

3. In one phrase, state the purpose of your essay. Consider what you want to happen when other people read your article.

4. Examine your notes and construct a list of all the key things you wish to emphasize. Make use of brainstorming strategies and jot down any ideas that come to mind.

5. Review and revise the arguments and write a thesis statement for a research paper or essay about depression.

6. Organize your essay by organizing the list of points. Arrange the points in a logical sequence. Analyze all elements to ensure that they are all relevant to your goal.

7. Reread all of your statements and arrange your outline in a standard manner, such as a bulleted list.

Final Words

So, what is an ideal way to write a thesis statement about depression for your research paper or essay? We hope you have a thorough idea of the essay you’re writing before picking a thesis statement about mental well-being. That will assist you in developing the greatest thesis for our essay.

But don’t get too worked up over your thesis statement for a research paper on mental disorders. Our professional subject experts have produced a list of thesis statements about mental health and depression themes for research paper writing, so you’ve got your job cut out for you. For your essay assignments or assignments, we will also offer appropriate thesis statements.

If you’re still confused about which statement to use, contact us right away. We have a staff of highly qualified and seasoned writers who can assist you with your essay or research work and guarantee that you receive the highest possible score.

Related Posts

Can You Go to Jail for Plagiarism?

• July 17, 2023

ChatGPT Writer Extension: Boosting Your Writing Efficiency

• June 23, 2023

ChatGPT Plagiarism Detection: Ensuring Originality in AI-Generated Content

• May 29, 2023

Advertisement

Major Depressive Disorder: Advances in Neuroscience Research and Translational Applications

• Open access
• Published: 13 February 2021
• Volume 37 , pages 863–880, ( 2021 )

Cite this article

You have full access to this open access article

• Zezhi Li 1 , 2 ,
• Meihua Ruan 3 ,
• Jun Chen 1 , 5 &
• Yiru Fang   ORCID: orcid.org/0000-0002-8748-9085 1 , 4 , 5  

48k Accesses

119 Citations

16 Altmetric

Explore all metrics

A Correction to this article was published on 17 May 2021

This article has been updated

Major depressive disorder (MDD), also referred to as depression, is one of the most common psychiatric disorders with a high economic burden. The etiology of depression is still not clear, but it is generally believed that MDD is a multifactorial disease caused by the interaction of social, psychological, and biological aspects. Therefore, there is no exact pathological theory that can independently explain its pathogenesis, involving genetics, neurobiology, and neuroimaging. At present, there are many treatment measures for patients with depression, including drug therapy, psychotherapy, and neuromodulation technology. In recent years, great progress has been made in the development of new antidepressants, some of which have been applied in the clinic. This article mainly reviews the research progress, pathogenesis, and treatment of MDD.

Similar content being viewed by others

Introduction

Neuroimaging advance in depressive disorder.

The cellular and molecular basis of major depressive disorder: towards a unified model for understanding clinical depression

Avoid common mistakes on your manuscript.

Major depressive disorder (MDD) also referred to as depression, is one of the most severe and common psychiatric disorders across the world. It is characterized by persistent sadness, loss of interest or pleasure, low energy, worse appetite and sleep, and even suicide, disrupting daily activities and psychosocial functions. Depression has an extreme global economic burden and has been listed as the third largest cause of disease burden by the World Health Organization since 2008, and is expected to rank the first by 2030 [ 1 , 2 ]. In 2016, the Global Burden of Diseases, Injuries, and Risk Factors Study demonstrated that depression caused 34.1 million of the total years lived with disability (YLDs), ranking as the fifth largest cause of YLD [ 3 ]. Therefore, the research progress and the clinical application of new discoveries or new technologies are imminent. In this review, we mainly discuss the current situation of research, developments in pathogenesis, and the management of depression.

Current Situation of Research on Depression

Analysis of published papers.

In the past decade, the total number of papers on depression published worldwide has increased year by year as shown in Fig. 1 A. Searching the Web of Science database, we found a total of 43,863 papers published in the field of depression from 2009 to 2019 (search strategy: TI = (depression$) or ts = ("major depressive disorder$")) and py = (2009 – 2019), Articles). The top 10 countries that published papers on the topic of depression are shown in Fig. 1 B. Among them, researchers in the USA published the most papers, followed by China. Compared with the USA, the gap in the total number of papers published in China is gradually narrowing (Fig. 1 C), but the quality gap reflected by the index (the total number of citations and the number of citations per paper) is still large, and is lower than the global average (Fig. 1 D). As shown in Fig. 1 E, the hot research topics in depression are as follows: depression management in primary care, interventions to prevent depression, the pathogenesis of depression, comorbidity of depression and other diseases, the risks of depression, neuroimaging studies of depression, and antidepressant treatment.

Analysis of published papers around the world from 2009 to 2019 in depressive disorder. A The total number of papers [from a search of the Web of Science database (search strategy: TI = (depression$) or ts = ("major depressive disorder$")) and py = (2009 – 2019), Articles)]. B The top 10 countries publishing on the topic. C Comparison of papers in China and the USA. D Citations for the top 10 countries and comparison with the global average. E Hot topics.

Analysis of Patented Technology Application

There were 16,228 patent applications in the field of depression between 2009 and 2019, according to the Derwent Innovation Patent database. The annual number and trend of these patents are shown in Fig. 2 A. The top 10 countries applying for patents related to depression are shown in Fig. 2 B. The USA ranks first in the number of depression-related patent applications, followed by China. The largest number of patents related to depression is the development of antidepressants, and drugs for neurodegenerative diseases such as dementia comorbid with depression. The top 10 technological areas of patents related to depression are shown in Fig. 2 C, and the trend in these areas have been stable over the past decade (Fig. 2 D).

Analysis of patented technology applications from 2009 to 2019 in the field of depressive disorder. A Annual numbers and trends of patents (the Derwent Innovation patent database). B The top 10 countries/regions applying for patents. C The top 10 technological areas of patents. D The trend of patent assignees. E Global hot topic areas of patents.

Analysis of technical hotspots based on keyword clustering was conducted from the Derwent Innovation database using the "ThemeScape" tool. This demonstrated that the hot topic areas are as follows (Fig. 2 E): (1) improvement for formulation and the efficiency of hydrobromide, as well as optimization of the dosage; intervention for depression comorbid with AD, diabetes, and others; (3) development of alkyl drugs; (4) development of pharmaceutical acceptable salts as antidepressants; (5) innovation of the preparation of antidepressants; (6) development of novel antidepressants based on neurotransmitters; (7) development of compositions based on nicotinic acetylcholine receptors; and (8) intervention for depression with traditional Chinese medicine.

Analysis of Clinical Trial

There are 6,516 clinical trials in the field of depression in the ClinicalTrials.gov database, and among them, 1,737 valid trials include the ongoing recruitment of subjects, upcoming recruitment of subjects, and ongoing clinical trials. These clinical trials are mainly distributed in the USA (802 trials), Canada (155), China (114), France (93), Germany (66), UK (62), Spain (58), Denmark (41), Sweden (39), and Switzerland (23). The indications for clinical trials include various types of depression, such as minor depression, depression, severe depression, perinatal depression, postpartum depression, and depression comorbid with other psychiatric disorders or physical diseases, such as schizophrenia, epilepsy, stroke, cancer, diabetes, cardiovascular disease, and Parkinson's disease.

Based on the database of the Chinese Clinical Trial Registry website, a total of 143 clinical trials for depression have been carried out in China. According to the type of research, they are mainly interventional and observational studies, as well as a small number of related factor studies, epidemiological studies, and diagnostic trials. The research content involves postpartum, perinatal, senile, and other age groups with clinical diagnosis (imaging diagnosis) and intervention studies (drugs, acupuncture, electrical stimulation, transcranial magnetic stimulation). It also includes intervention studies on depression comorbid with coronary heart disease, diabetes, and heart failure.

New Medicine Development

According to the Cortellis database, 828 antidepressants were under development by the end of 2019, but only 292 of these are effective and active (Fig. 3 A). Large number of them have been discontinued or made no progress, indicating that the development of new drugs in the field of depression is extremely urgent.

New medicine development from 2009 to 2019 in depressive disorder. A Development status of new candidate drugs. B Top target-based actions.

From the perspective of target-based actions, the most common new drugs are NMDA receptor antagonists, followed by 5-HT targets, as well as dopamine receptor agonists, opioid receptor antagonists and agonists, AMPA receptor modulators, glucocorticoid receptor antagonists, NK1 receptor antagonists, and serotonin transporter inhibitors (Fig. 3 B).

Epidemiology of Depression

The prevalence of depression varies greatly across cultures and countries. Previous surveys have demonstrated that the 12-month prevalence of depression was 0.3% in the Czech Republic, 10% in the USA, 4.5% in Mexico, and 5.2% in West Germany, and the lifetime prevalence of depression was 1.0% in the Czech Republic, 16.9% in the USA, 8.3% in Canada, and 9.0% in Chile [ 4 , 5 ]. A recent meta-analysis including 30 Countries showed that lifetime and 12-month prevalence depression were 10.8% and 7.2%, respectively [ 6 ]. In China, the lifetime prevalence of depression ranged from 1.6% to 5.5% [ 7 , 8 , 9 ]. An epidemiological study demonstrated that depression was the most common mood disorder with a life prevalence of 3.4% and a 12-month prevalence of 2.1% in China [ 10 ].

Some studies have also reported the prevalence in specific populations. The National Comorbidity Survey-Adolescent Supplement (NCS-A) survey in the USA showed that the lifetime and 12-month prevalence of depression in adolescents aged 13 to 18 were 11.0% and 7.5%, respectively [ 11 ]. A recent meta-analysis demonstrated that lifetime prevalence and 12-month prevalence were 2.8% and 2.3%, respectively, among the elderly population in China [ 12 ].

Neurobiological Pathogenesis of Depressive Disorder

The early hypothesis of monoamines in the pathophysiology of depression has been accepted by the scientific community. The evidence that monoamine oxidase inhibitors and tricyclic antidepressants promote monoamine neurotransmission supports this theory of depression [ 13 ]. So far, selective serotonin reuptake inhibitors and norepinephrine reuptake inhibitors are still the first-line antidepressants. However, there remain 1/3 to 2/3 of depressed patients who do not respond satisfactorily to initial antidepressant treatment, and even as many as 15%–40% do not respond to several pharmacological medicines [ 14 , 15 ]. Therefore, the underlying pathogenesis of depression is far beyond the simple monoamine mechanism.

Other hypotheses of depression have gradually received increasing attention because of biomarkers for depression and the effects pharmacological treatments, such as the stress-responsive hypothalamic pituitary adrenal (HPA) axis, neuroendocrine systems, the neurotrophic family of growth factors, and neuroinflammation.

Stress-Responsive HPA Axis

Stress is causative or a contributing factor to depression. Particularly, long-term or chronic stress can lead to dysfunction of the HPA axis and promote the secretion of hormones, including cortisol, adrenocorticotropic hormone, corticotropin-releasing hormone, arginine vasopressin, and vasopressin. About 40%–60% of patients with depression display a disturbed HPA axis, including hypercortisolemia, decreased rhythmicity, and elevated cortisol levels [ 16 , 17 ]. Mounting evidence has shown that stress-induced abnormality of the HPA axis is associated with depression and cognitive impairment, which is due to the increased secretion of cortisol and the insufficient inhibition of glucocorticoid receptor regulatory feedback [ 18 , 19 ]. In addition, it has been reported that the increase in cortisol levels is related to the severity of depression, especially in melancholic depression [ 20 , 21 ]. Further, patients with depression whose HPA axis was not normalized after treatment had a worse clinical response and prognosis [ 22 , 23 ]. Despite the above promising insights, unfortunately previous studies have shown that treatments regulating the HPA axis, such as glucocorticoid receptor antagonists, do not attenuate the symptoms of depressed patients [ 24 , 25 ].

Glutamate Signaling Pathway

Glutamate is the main excitatory neurotransmitter released by synapses in the brain; it is involved in synaptic plasticity, cognitive processes, and reward and emotional processes. Stress can induce presynaptic glutamate secretion by neurons and glutamate strongly binds to ionotropic glutamate receptors (iGluRs) including N-methyl-D-aspartate receptors (NMDARs) and α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptors (AMPARs) [ 26 ] on the postsynaptic membrane to activate downstream signal pathways [ 27 ]. Accumulating evidence has suggested that the glutamate system is associated with the incidence of depression. Early studies have shown increased levels of glutamate in the peripheral blood, cerebrospinal fluid, and brain of depressed patients [ 28 , 29 ], as well as NMDAR subunit disturbance in the brain [ 30 , 31 ]. Blocking the function of NMDARs has an antidepressant effect and protects hippocampal neurons from morphological abnormalities induced by stress, while antidepressants reduce glutamate secretion and NMDARs [ 32 ]. Most importantly, NMDAR antagonists such as ketamine have been reported to have profound and rapid antidepressant effects on both animal models and the core symptoms of depressive patients [ 33 ]. On the other hand, ketamine can also increase the AMPAR pathway in hippocampal neurons by up-regulating the AMPA glutamate receptor 1 subunit [ 34 ]. Further, the AMPAR pathway may be involved in the mechanism of antidepressant effects. For example, preclinical studies have indicated that AMPAR antagonists might attenuate lithium-induced depressive behavior by increasing the levels of glutamate receptors 1 and 2 in the mouse hippocampus [ 35 ].

Gamma-Aminobutyric Acid (GABA)

Contrary to glutamate, GABA is the main inhibitory neurotransmitter. Although GABA neurons account for only a small proportion compared to glutamate, inhibitory neurotransmission is essential for brain function by balancing excitatory transmission [ 36 ]. Number of studies have shown that patients with depression have neurotransmission or functional defects of GABA [ 37 , 38 ]. Schür et al ., conducted a meta-analysis of magnetic resonance spectroscopy studies, which showed that the brain GABA level in depressive patients was lower than that in healthy controls, but no difference was found in depressive patients in remission [ 39 ]. Several postmortem studies have shown decreased levels of the GABA synthase glutamic acid decarboxylase in the prefrontal cortex of patients with depression [ 40 , 41 ]. It has been suggested that a functional imbalance of the GABA and glutamate systems contributes to the pathophysiology of depression, and activation of the GABA system might induce antidepressant activity, by which GABA A  receptor mediators α2/α3 are considered potential antidepressant candidates [ 42 , 43 ]. Genetic mouse models, such as the GABA A receptor mutant mouse and conditional the Gad1-knockout mouse (GABA in hippocampus and cerebral cortex decreased by 50%) and optogenetic methods have verified that depression-like behavior is induced by changing the level of GABA [ 44 , 45 ].

Neurotrophin Family

The neurotrophin family plays a key role in neuroplasticity and neurogenesis. The neurotrophic hypothesis of depression postulates that a deficit of neurotrophic support leads to neuronal atrophy, the reduction of neurogenesis, and the destruction of glia support, while antidepressants attenuate or reverse these pathophysiological processes [ 46 ]. Among them, the most widely accepted hypothesis involves brain-derived neurotrophic factor (BDNF). This was initially triggered by evidence that stress reduces the BDNF levels in the animal brain, while antidepressants rescue or attenuate this reduction [ 47 , 48 ], and agents involved in the BDNF system have been reported to exert antidepressant-like effects [ 49 , 50 ]. In addition, mounting studies have reported that the BDNF level is decreased in the peripheral blood and at post-mortem in depressive patients, and some have reported that antidepressant treatment normalizes it [ 51 , 52 ]. Furthermore, some evidence also showed that the interaction of BDNF and its receptor gene is associated with treatment-resistant depression [ 15 ].

Recent studies reported that depressed patients have a lower level of the pro-domain of BDNF (BDNF pro-peptide) than controls. This is located presynaptically and promotes long-term depression in the hippocampus, suggesting that it is a promising synaptic regulator [ 53 ].

Neuroinflammation

The immune-inflammation hypothesis has attracted much attention, suggesting that the interactions between inflammatory pathways and neural circuits and neurotransmitters are involved in the pathogenesis and pathophysiological processes of depression. Early evidence found that patients with autoimmune or infectious diseases are more likely to develop depression than the general population [ 54 ]. In addition, individuals without depression may display depressive symptoms after treatment with cytokines or cytokine inducers, while antidepressants relieve these symptoms [ 55 , 56 ]. There is a complex interaction between the peripheral and central immune systems. Previous evidence suggested that peripheral inflammation/infection may spread to the central nervous system in some way and cause a neuroimmune response [ 55 , 57 ]: (1) Some cytokines produced in the peripheral immune response, such as IL-6 and IL-1 β, can leak into the brain through the blood-brain barrier (BBB). (2) Cytokines entering the central nervous system act directly on astrocytes, small stromal cells, and neurons. (3) Some peripheral immune cells can cross the BBB through specific transporters, such as monocytes. (4) Cytokines and chemokines in the circulation activate the central nervous system by regulating the surface receptors of astrocytes and endothelial cells at the BBB. (5) As an intermediary pathway, the immune inflammatory response transmits peripheral danger signals to the center, amplifies the signals, and shows the external phenotype of depressive behavior associated with stress/trauma/infection. (6) Cytokines and chemokines may act directly on neurons, change their plasticity and promote depression-like behavior.

Patients with depression show the core feature of the immune-inflammatory response, that is, increased concentrations of pro-inflammatory cytokines and their receptors, chemokines, and soluble adhesion molecules in peripheral blood and cerebrospinal fluid [ 58 , 59 , 60 ]. Peripheral immune-inflammatory response markers not only change the immune activation state in the brain that affects explicit behavior, but also can be used as an evaluation index or biological index of antidepressant therapy [ 61 , 62 ]. Li et al . showed that the level of TNF-α in patients with depression prior to treatment was higher than that in healthy controls. After treatment with venlafaxine, the level of TNF-α in patients with depression decreased significantly, and the level of TNF-α in the effective group decreased more [ 63 ]. A recent meta-analysis of 1,517 patients found that antidepressants significantly reduced peripheral IL-6, TNF-α, IL-10, and CCL-2, suggesting that antidepressants reduce markers of peripheral inflammatory factors [ 64 ]. Recently, Syed et al . also confirmed that untreated patients with depression had higher levels of inflammatory markers and increased levels of anti-inflammatory cytokines after antidepressant treatment, while increased levels of pro-inflammatory cytokines were found in non-responders [ 62 ]. Clinical studies have also found that anti-inflammatory cytokines, such as monoclonal antibodies and other cytokine inhibitors, may play an antidepressant role by blocking cytokines. The imbalance of pro-inflammatory and anti-inflammatory cytokines may be involved in the pathophysiological process of depression.

In addition, a recent study showed that microglia contribute to neuronal plasticity and neuroimmune interaction that are involved in the pathophysiology of depression [ 65 ]. When activated microglia promote inflammation, especially the excessive production of pro-inflammatory factors and cytotoxins in the central nervous system, depression-like behavior can gradually develop [ 65 , 66 ]. However, microglia change polarization as two types under different inflammatory states, regulating the balance of pro- and anti-inflammatory factors. These two types are M1 and M2 microglia; the former produces large number of pro-inflammatory cytokines after activation, and the latter produces anti-inflammatory cytokines. An imbalance of M1/M2 polarization of microglia may contribute to the pathophysiology of depression [ 67 ].

Microbiome-Gut-Brain Axis

The microbiota-gut-brain axis has recently gained more attention because of its ability to regulate brain activity. Many studies have shown that the microbiota-gut-brain axis plays an important role in regulating mood, behavior, and neuronal transmission in the brain [ 68 , 69 ]. It is well established that comorbidity of depression and gastrointestinal diseases is common [ 70 , 71 ]. Some antidepressants can attenuate the symptoms of patients with irritable bowel syndrome and eating disorders [ 72 ]. It has been reported that gut microbiome alterations are associated with depressive-like behaviors [ 73 , 74 ], and brain function [ 75 ]. Early animal studies have shown that stress can lead to long-term changes in the diversity and composition of intestinal microflora, and is accompanied by depressive behavior [ 76 , 77 ]. Interestingly, some evidence indicates that rodents exhibit depressive behavior after fecal transplants from patients with depression [ 74 ]. On the other hand, some probiotics attenuated depressive-like behavior in animal studies, [ 78 ] and had antidepressant effects on patients with depression in several double-blind, placebo-controlled clinical trials [ 79 , 80 ].

The potential mechanism may be that gut microbiota can interact with the brain through a variety of pathways or systems, including the HPA axis, and the neuroendocrine, autonomic, and neuroimmune systems [ 81 ]. For example, recent evidence demonstrated that gut microbiota can affect the levels of neurotransmitters in the gut and brain, including serotonin, dopamine, noradrenalin, glutamate, and GABA [ 82 ]. In addition, recent studies showed that changes in gut microbiota can also impair the gut barrier and promote higher levels of peripheral inflammatory cytokines [ 83 , 84 ]. Although recent research in this area has made significant progress, more clinical trials are needed to determine whether probiotics have any effect on the treatment of depression and what the potential underlying mechanisms are.

Other Systems and Pathways

There is no doubt that several other systems or pathways are also involved in the pathophysiology of depression, such as oxidant-antioxidant imbalance [ 85 ], mitochondrial dysfunction [ 86 , 87 ], and circadian rhythm-related genes [ 88 ], especially their critical interactions ( e.g. interaction between the HPA and mitochondrial metabolism [ 89 , 90 ], and the reciprocal interaction between oxidative stress and inflammation [ 2 , 85 ]). The pathogenesis of depression is complex and all the hypotheses should be integrated to consider the many interactions between various systems and pathways.

Advances in Various Kinds of Research on Depressive Disorder

Genetic, molecular, and neuroimaging studies continue to increase our understanding of the neurobiological basis of depression. However, it is still not clear to what extent the results of neurobiological studies can help improve the clinical and functional prognosis of patients. Therefore, over the past 10 years, the neurobiological study of depression has become an important measure to understand the pathophysiological mechanism and guide the treatment of depression.

Genetic Studies

Previous twin and adoption studies have indicated that depression has relatively low rate of heritability at 37% [ 91 ]. In addition, environmental factors such as stressful events are also involved in the pathogenesis of depression. Furthermore, complex psychiatric disorders, especially depression, are considered to be polygenic effects that interact with environmental factors [ 13 ]. Therefore, reliable identification of single causative genes for depression has proved to be challenging. The first genome-wide association studies (GWAS) for depression was published in 2009, and included 1,738 patients and 1,802 controls [ 92 , 93 ]. Although many subsequent GWASs have determined susceptible genes in the past decade, the impact of individual genes is so small that few results can be replicated [ 94 , 95 ]. So far, it is widely accepted that specific single genetic mutations may play minor and marginal roles in complex polygenic depression. Another major recognition in GWASs over the past decade is that prevalent candidate genes are usually not associated with depression. Further, the inconsistent results may also be due to the heterogeneity and polygenic nature of genetic and non-genetic risk factors for depression as well as the heterogeneity of depression subtypes [ 95 , 96 ]. Therefore, to date, the quality of research has been improved in two aspects: (1) the sample size has been maximized by combining the data of different evaluation models; and (2) more homogenous subtypes of depression have been selected to reduce phenotypic heterogeneity [ 97 ]. Levinson et al . pointed out that more than 75,000 to 100,000 cases should be considered to detect multiple depression associations [ 95 ]. Subsequently, several recent GWASs with larger sample sizes have been conducted. For example, Okbay et al . identified two loci associated with depression and replicated them in separate depression samples [ 98 ]. Wray et al . also found 44 risk loci associated with depression based on 135,458 cases and 344,901 controls [ 99 ]. A recent GWAS of 807,553 individuals with depression reported that 102 independent variants were associated with depression; these were involved in synaptic structure and neural transmission, and were verified in a further 1,507,153 individuals [ 100 ]. However, even with enough samples, GWASs still face severe challenges. A GWAS only marks the region of the genome and is not directly related to the potential biological function. In addition, a genetic association with the indicative phenotype of depression may only be part of many pathogenic pathways, or due to the indirect influence of intermediate traits in the causal pathway on the final result [ 101 ].

Given the diversity of findings, epigenetic factors are now being investigated. Recent studies indicated that epigenetic mechanisms may be the potential causes of "loss of heritability" in GWASs of depression. Over the past decade, a promising discovery has been that the effects of genetic information can be directly influenced by environment factors, and several specific genes are activated by environmental aspects. This process is described as interactions between genes and the environment, which is identified by the epigenetic mechanism. Environmental stressors cause alterations in gene expression in the brain, which may cause abnormal neuronal plasticity in areas related to the pathogenesis of the disease. Epigenetic events alter the structure of chromatin, thereby regulating gene expression involved in neuronal plasticity, stress behavior, depressive behavior, and antidepressant responses, including DNA methylation, histone acetylation, and the role of non-coding RNA. These new mechanisms of trans-generational transmission of epigenetic markers are considered a supplement to orthodox genetic heredity, providing the possibility for the discovery of new treatments for depression [ 102 , 103 ]. Recent studies imply that life experiences, including stress and enrichment, may affect cellular and molecular signaling pathways in sperm and influence the behavioral and physiological phenotypes of offspring in gender-specific patterns, which may also play an important role in the development of depression [ 103 ].

Brain Imaging and Neuroimaging Studies

Neuroimaging, including magnetic resonance imaging (MRI) and molecular imaging, provides a non-invasive technique for determining the underlying etiology and individualized treatment for depression. MRI can provide important data on brain structure, function, networks, and metabolism in patients with depression; it includes structural MRI (sMRI), functional MRI (fMRI), diffusion tensor imaging, and magnetic resonance spectroscopy.

Previous sMRI studies have found damaged gray matter in depression-associated brain areas, including the frontal lobe, anterior cingulate gyrus, hippocampus, putamen, thalamus, and amygdala. sMRI focuses on the thickness of gray matter and brain morphology [ 104 , 105 ]. A recent meta-analysis of 2,702 elderly patients with depression and 11,165 controls demonstrated that the volumes of the whole brain and hippocampus of patients with depression were lower than those of the control group [ 106 ]. Some evidence also showed that the hippocampal volume in depressive patients was lower than that of controls, and increased after treatment with antidepressants [ 107 ] and electroconvulsive therapy (ECT) [ 108 ], suggesting that the hippocampal volume plays a critical role in the development, treatment response, and clinical prognosis of depression. A recent study also reported that ECT increased the volume of the right hippocampus, amygdala, and putamen in patients with treatment-resistant depression [ 109 ]. In addition, postmortem research supported the MRI study showing that dentate gyrus volume was decreased in drug-naive patients with depression compared to healthy controls, and was potentially reversed by treatment with antidepressants [ 110 ].

Diffusion tensor imaging detects the microstructure of the white matter, which has been reported impaired in patients with depression [ 111 ]. A recent meta-analysis that included first-episode and drug-naïve depressive patients showed that the decrease in fractional anisotropy was negatively associated with illness duration and clinical severity [ 112 ].

fMRI, including resting-state and task-based fMRI, can divide the brain into self-related regions, such as the anterior cingulate cortex, posterior cingulate cortex, medial prefrontal cortex, precuneus, and dorsomedial thalamus. Many previous studies have shown the disturbance of several brain areas and intrinsic neural networks in patients with depression which could be rescued by antidepressants [ 113 , 114 , 115 , 116 ]. Further, some evidence also showed an association between brain network dysfunction and the clinical correlates of patients with depression, including clinical symptoms [ 117 ] and the response to antidepressants [ 118 , 119 ], ECT [ 120 , 121 ], and repetitive transcranial magnetic stimulation [ 122 ].

It is worth noting that brain imaging provides new insights into the large-scale brain circuits that underlie the pathophysiology of depressive disorder. In such studies, large-scale circuits are often referred to as “networks”. There is evidence that a variety of circuits are involved in the mechanisms of depressive disorder, including disruption of the default mode, salience, affective, reward, attention, and cognitive control circuits [ 123 ]. Over the past decade, the study of intra-circuit and inter-circuit connectivity dysfunctions in depression has escalated, in part due to advances in precision imaging and analysis techniques [ 124 ]. Circuit dysfunction is a potential biomarker to guide psychopharmacological treatment. For example, Williams et al . found that hyper-activation of the amygdala is associated with a negative phenotype that can predict the response to antidepressants [ 125 ]. Hou et al . showed that the baseline characteristics of the reward circuit predict early antidepressant responses [ 126 ].

Molecular imaging studies, including single photon emission computed tomography and positron emission tomography, focus on metabolic aspects such as amino-acids, neurotransmitters, glucose, and lipids at the cellular level in patients with depression. A recent meta-analysis examined glucose metabolism and found that glucose uptake dysfunction in different brain regions predicts the treatment response [ 127 ].

The most important and promising studies were conducted by the ENIGMA (Enhancing NeuroImaging Genetics through Meta Analysis) Consortium, which investigated the human brain across 43 countries. The ENIGMA-MDD Working Group was launched in 2012 to detect the structural and functional changes associated with MDD reliably and replicate them in various samples around the world [ 128 ]. So far, the ENIGMA-MDD Working Group has collected data from 4,372 MDD patients and 9,788 healthy controls across 14 countries, including 45 cohorts [ 128 ]. Their findings to date are shown in Table 1 [ 128 , 129 , 130 , 131 , 132 , 133 , 134 , 135 , 136 , 137 ].

Objective Index for Diagnosis of MDD

To date, the clinical diagnosis of depression is subjectively based on interviews according to diagnostic criteria ( e.g. International Classification of Diseases and Diagnostic and Statistical Manual diagnostic systems) and the severity of clinical symptoms are assessed by questionnaires, although patients may experience considerable differences in symptoms and subtypes [ 138 ]. Meanwhile, biomarkers including genetics, epigenetics, peripheral gene and protein expression, and neuroimaging markers may provide a promising supplement for the development of the objective diagnosis of MDD, [ 139 , 140 , 141 ]. However, the development of reliable diagnosis for MDD using biomarkers is still difficult and elusive, and all methods based on a single marker are insufficiently specific and sensitive for clinical use [ 142 ]. Papakostas et al . showed that a multi-assay, serum-based test including nine peripheral biomarkers (soluble tumor necrosis factor alpha receptor type II, resistin, prolactin, myeloperoxidase, epidermal growth factor, BDNF, alpha1 antitrypsin, apolipoprotein CIII, brain-derived neurotrophic factor, and cortisol) yielded a specificity of 81.3% and a sensitivity of 91.7% [ 142 ]. However, the sample size was relatively small and no other studies have yet validated their results. Therefore, further studies are needed to identify biomarker models that integrate all biological variables and clinical features to improve the specificity and sensitivity of diagnosis for MDD.

Management of Depression

The treatment strategies for depression consist of pharmacological treatment and non-pharmacological treatments including psychotherapy, ECT [ 98 ], and transcranial magnetic stimulation. As psychotherapy has been shown to have effects on depression including attenuating depressive symptoms and improving the quality of life [ 143 , 144 ]; several practice guidelines are increasingly recommending psychotherapy as a monotherapy or in combination with antidepressants [ 145 , 146 ].

Current Antidepressant Treatment

Antidepressants approved by the US Food and Drug Administration (FDA) are shown in Table 2 . Due to the relatively limited understanding of the etiology and pathophysiology of depression, almost all the previous antidepressants were discovered by accident a few decades ago. Although most antidepressants are usually safe and effective, there are still some limitations, including delayed efficacy (usually 2 weeks) and side-effects that affect the treatment compliance [ 147 ]. In addition, <50% of all patients with depression show complete remission through optimized treatment, including trials of multiple drugs with and without simultaneous psychotherapy. In the past few decades, most antidepressant discoveries focused on finding faster, safer, and more selective serotonin or norepinephrine receptor targets. In addition, there is an urgent need to develop new approaches to obtain more effective, safer, and faster antidepressants. In 2019, the FDA approved two new antidepressants: Esketamine for refractory depression and Bresanolone for postpartum depression. Esmolamine, a derivative of the anesthetic drug ketamine, was approved by the FDA for the treatment of refractory depression, based on a large number of preliminary clinical studies [ 148 ]. For example, several randomized controlled trials and meta-analysis studies showed the efficacy and safety of Esketamine in depression or treatment-resistant depression [ 26 , 149 , 150 ]. Although both are groundbreaking new interventions for these debilitating diseases and both are approved for use only under medical supervision, there are still concerns about potential misuse and problems in the evaluation of mental disorders [ 151 ].

To date, although several potential drugs have not yet been approved by the FDA, they are key milestones in the development of antidepressants that may be modified and used clinically in the future, such as compounds containing dextromethorphan (a non-selective NMDAR antago–nist), sarcosine (N-methylglycine, a glycine reuptake inhibitor), AMPAR modulators, and mGluR modulators [ 152 ].

Neuromodulation Therapy

Neuromodulation therapy acts through magnetic pulse, micro-current, or neural feedback technology within the treatment dose, acting on the central or peripheral nervous system to regulate the excitatory/inhibitory activity to reduce or attenuate the symptoms of the disease.

ECT is one of most effective treatments for depression, with the implementation of safer equipment and advancement of techniques such as modified ECT [ 153 ]. Mounting evidence from randomized controlled trial (RCT) and meta-analysis studies has shown that rTMS can treat depressive patients with safety [ 154 ]. Other promising treatments for depression have emerged, such as transcranial direct current stimulation (tDCS) [ 155 ], transcranial alternating current stimulation (tACS)[ 156 ], vagal nerve stimulation [ 157 ], deep brain stimulation [ 158 ] , and light therapy [ 159 ], but some of them are still experimental to some extent and have not been widely used. For example, compared to tDCS, tACS displays less sensory experience and adverse reactions with weak electrical current in a sine-wave pattern, but the evidence for the efficacy of tACS in the treatment of depression is still limited [ 160 ]. Alexander et al . recently demonstrated that there was no difference in efficacy among different treatments (sham, 10-Hz and 40-Hz tACS). However, only the 10-Hz tACS group had more responders than the sham and 40-Hz tACS groups at week 2 [ 156 ]. Further RCT studies are needed to verify the efficacy of tACS. In addition, the mechanism of the effect of neuromodulation therapy on depression needs to be further investigated.

Precision Medicine for Depression

Optimizing the treatment strategy is an effective way to improve the therapeutic effect on depression. However, each individual with depression may react very differently to different treatments. Therefore, this raises the question of personalized treatment, that is, which patients are suitable for which treatment. Over the past decade, psychiatrists and psychologists have focused on individual biomarkers and clinical characteristics to predict the efficiency of antidepressants and psychotherapies, including genetics, peripheral protein expression, electrophysiology, neuroimaging, neurocognitive performance, developmental trauma, and personality [ 161 ]. For example, Bradley et al . recently conducted a 12-week RCT, which demonstrated that the response rate and remission rates of the pharmacogenetic guidance group were significantly higher than those of the non-pharmacogenetic guidance group [ 162 ].

Subsequently, Greden et al . conducted an 8-week RCT of Genomics Used to Improve Depression Decisions (GUIDED) on 1,167 MDD patients and demonstrated that although there was no difference in symptom improvement between the pharmacogenomics-guided and non- pharmacogenomics-guided groups, the response rate and remission rate of the pharmacogenomics-guided group increased significantly [ 163 ].

A recent meta-analysis has shown that the baseline default mode network connectivity in patients with depression can predict the clinical responses to treatments including cognitive behavioral therapy, pharmacotherapy, ECT, rTMS, and transcutaneous vagus nerve stimulation [ 164 ]. However, so far, the biomarkers that predict treatment response at the individual level have not been well applied in the clinic, and there is still a lot of work to be conducted in the future.

Future Perspectives

Although considerable progress has been made in the study of depression during a past decade, the heterogeneity of the disease, the effectiveness of treatment, and the gap in translational medicine are critical challenges. The main dilemma is that our understanding of the etiology and pathophysiology of depression is inadequate, so our understanding of depression is not deep enough to develop more effective treatment. Animal models still cannot fully simulate this heterogeneous and complex mental disorder. Therefore, how to effectively match the indicators measured in animals with those measured in genetic research or the development of new antidepressants is another important challenge.

Change history

17 may 2021.

A Correction to this paper has been published: https://doi.org/10.1007/s12264-021-00694-9

Dadi AF, Miller ER, Bisetegn TA, Mwanri L. Global burden of antenatal depression and its association with adverse birth outcomes: an umbrella review. BMC Public Health 2020, 20: 173

Article   PubMed   PubMed Central   Google Scholar  

Zhu S, Zhao L, Fan Y, Lv Q, Wu K, Lang X. Interaction between TNF-alpha and oxidative stress status in first-episode drug-naive schizophrenia. Psychoneuroendocrinology 2020, 114: 104595

Article   CAS   PubMed   Google Scholar  

Disease GBD, Injury I, Prevalence C. Global, regional, and national incidence, prevalence, and years lived with disability for 328 diseases and injuries for 195 countries, 1990–2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet 2017, 390: 1211–1259

Article   Google Scholar  

Andrade L, Caraveo-Anduaga JJ, Berglund P, Bijl RV, De Graaf R, Vollebergh W, et al. The epidemiology of major depressive episodes: results from the International Consortium of Psychiatric Epidemiology (ICPE) Surveys. Int J Methods Psychiatr Res 2003, 12: 3–21

Article   PubMed   Google Scholar  

Kessler RC, Bromet EJ. The epidemiology of depression across cultures. Annu Rev Public Health 2013, 34: 119–138

Lim GY, Tam WW, Lu Y, Ho CS, Zhang MW, Ho RC. Prevalence of depression in the community from 30 countries between 1994 and 2014. Sci Rep 2018, 8: 2861

Liu J, Yan F, Ma X, Guo HL, Tang YL, Rakofsky JJ, et al. Prevalence of major depressive disorder and socio-demographic correlates: Results of a representative household epidemiological survey in Beijing, China. J Affect Disord 2015, 179: 74–81

Zhang YS, Rao WW, Cui LJ, Li JF, Li L, Ng CH, et al. Prevalence of major depressive disorder and its socio-demographic correlates in the general adult population in Hebei province, China. J Affect Disord 2019, 252: 92–98

Ma X, Xiang YT, Cai ZJ, Li SR, Xiang YQ, Guo HL, et al. Prevalence and socio-demographic correlates of major depressive episode in rural and urban areas of Beijing, China. J Affect Disord 2009, 115: 323–330

Huang Y, Wang Y, Wang H, Liu Z, Yu X, Yan J, et al. Prevalence of mental disorders in China: a cross-sectional epidemiological study. Lancet Psychiatry 2019, 6: 211–224

Avenevoli S, Swendsen J, He JP, Burstein M, Merikangas KR. Major depression in the national comorbidity survey-adolescent supplement: prevalence, correlates, and treatment. J Am Acad Child Adolesc Psychiatry 2015, 54(37–44): e32

Google Scholar  

Wang F, Zhang QE, Zhang L, Ng CH, Ungvari GS, Yuan Z, et al. Prevalence of major depressive disorder in older adults in China: A systematic review and meta-analysis. J Affect Disord 2018, 241: 297–304

Krishnan V, Nestler EJ. The molecular neurobiology of depression. Nature 2008, 455: 894–902

Article   CAS   PubMed   PubMed Central   Google Scholar  

Rush AJ, Trivedi MH, Wisniewski SR, Nierenberg AA, Stewart JW, Warden D, et al. Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: a STAR*D report. Am J Psychiatry 2006, 163: 1905–1917

Li Z, Zhang Y, Wang Z, Chen J, Fan J, Guan Y, et al. The role of BDNF, NTRK2 gene and their interaction in development of treatment-resistant depression: data from multicenter, prospective, longitudinal clinic practice. J Psychiatr Res 2013, 47: 8–14

Murphy BE. Steroids and depression. J Steroid Biochem Mol Biol 1991, 38: 537–559

Pariante CM, Lightman SL. The HPA axis in major depression: classical theories and new developments. Trends Neurosci 2008, 31: 464–468

Keller J, Gomez R, Williams G, Lembke A, Lazzeroni L, Murphy GM Jr, et al. HPA axis in major depression: cortisol, clinical symptomatology and genetic variation predict cognition. Mol Psychiatry 2017, 22: 527–536

Gomez RG, Fleming SH, Keller J, Flores B, Kenna H, DeBattista C, et al. The neuropsychological profile of psychotic major depression and its relation to cortisol. Biol Psychiatry 2006, 60: 472–478

Lamers F, Vogelzangs N, Merikangas KR, de Jonge P, Beekman AT, Penninx BW. Evidence for a differential role of HPA-axis function, inflammation and metabolic syndrome in melancholic versus atypical depression. Mol Psychiatry 2013, 18: 692–699

Nandam LS, Brazel M, Zhou M, Jhaveri DJ. Cortisol and major depressive disorder-translating findings from humans to animal models and back. Front Psychiatry 2019, 10: 974

Owashi T, Otsubo T, Oshima A, Nakagome K, Higuchi T, Kamijima K. Longitudinal neuroendocrine changes assessed by dexamethasone/CRH and growth hormone releasing hormone tests in psychotic depression. Psychoneuroendocrinology 2008, 33: 152–161

Mickey BJ, Ginsburg Y, Sitzmann AF, Grayhack C, Sen S, Kirschbaum C, et al. Cortisol trajectory, melancholia, and response to electroconvulsive therapy. J Psychiatr Res 2018, 103: 46–53

Stetler C, Miller GE. Depression and hypothalamic-pituitary-adrenal activation: a quantitative summary of four decades of research. Psychosom Med 2011, 73: 114–126

Aubry JM. CRF system and mood disorders. J Chem Neuroanat 2013, 54: 20–24

Correia-Melo FS, Leal GC, Vieira F, Jesus-Nunes AP, Mello RP, Magnavita G, et al. Efficacy and safety of adjunctive therapy using esketamine or racemic ketamine for adult treatment-resistant depression: A randomized, double-blind, non-inferiority study. J Affect Disord 2020, 264: 527–534

Duman RS, Voleti B. Signaling pathways underlying the pathophysiology and treatment of depression: novel mechanisms for rapid-acting agents. Trends Neurosci 2012, 35: 47–56

Sanacora G, Zarate CA, Krystal JH, Manji HK. Targeting the glutamatergic system to develop novel, improved therapeutics for mood disorders. Nat Rev Drug Discov 2008, 7: 426–437

Hashimoto K. The role of glutamate on the action of antidepressants. Prog Neuropsychopharmacol Biol Psychiatry 2011, 35: 1558–1568

Gray AL, Hyde TM, Deep-Soboslay A, Kleinman JE, Sodhi MS. Sex differences in glutamate receptor gene expression in major depression and suicide. Mol Psychiatry 2015, 20: 1057–1068

Chandley MJ, Szebeni A, Szebeni K, Crawford JD, Stockmeier CA, Turecki G, et al. Elevated gene expression of glutamate receptors in noradrenergic neurons from the locus coeruleus in major depression. Int J Neuropsychopharmacol 2014, 17: 1569–1578

Musazzi L, Treccani G, Mallei A, Popoli M. The action of antidepressants on the glutamate system: regulation of glutamate release and glutamate receptors. Biol Psychiatry 2013, 73: 1180–1188

Kadriu B, Musazzi L, Henter ID, Graves M, Popoli M, Zarate CA Jr. Glutamatergic Neurotransmission: Pathway to Developing Novel Rapid-Acting Antidepressant Treatments. Int J Neuropsychopharmacol 2019, 22: 119–135

Beurel E, Grieco SF, Amadei C, Downey K, Jope RS. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor signaling. Bipolar Disord 2016, 18: 473–480

Gould TD, O’Donnell KC, Dow ER, Du J, Chen G, Manji HK. Involvement of AMPA receptors in the antidepressant-like effects of lithium in the mouse tail suspension test and forced swim test. Neuropharmacology 2008, 54: 577–587

Duman RS, Sanacora G, Krystal JH. Altered Connectivity in Depression: GABA and Glutamate Neurotransmitter Deficits and Reversal by Novel Treatments. Neuron 2019, 102: 75–90

Ghosal S, Hare B, Duman RS. Prefrontal Cortex GABAergic Deficits and Circuit Dysfunction in the Pathophysiology and Treatment of Chronic Stress and Depression. Curr Opin Behav Sci 2017, 14: 1–8

Fee C, Banasr M, Sibille E. Somatostatin-positive gamma-aminobutyric acid interneuron deficits in depression: Cortical microcircuit and therapeutic perspectives. Biol Psychiatry 2017, 82: 549–559

Schur RR, Draisma LW, Wijnen JP, Boks MP, Koevoets MG, Joels M, et al. Brain GABA levels across psychiatric disorders: A systematic literature review and meta-analysis of (1) H-MRS studies. Hum Brain Mapp 2016, 37: 3337–3352

Guilloux JP, Douillard-Guilloux G, Kota R, Wang X, Gardier AM, Martinowich K, et al. Molecular evidence for BDNF- and GABA-related dysfunctions in the amygdala of female subjects with major depression. Mol Psychiatry 2012, 17: 1130–1142

Karolewicz B, Maciag D, O’Dwyer G, Stockmeier CA, Feyissa AM, Rajkowska G. Reduced level of glutamic acid decarboxylase-67 kDa in the prefrontal cortex in major depression. Int J Neuropsychopharmacol 2010, 13: 411–420

Lener MS, Niciu MJ, Ballard ED, Park M, Park LT, Nugent AC, et al. Glutamate and gamma-aminobutyric acid systems in the pathophysiology of major depression and antidepressant response to ketamine. Biol Psychiatry 2017, 81: 886–897

Chen X, van Gerven J, Cohen A, Jacobs G. Human pharmacology of positive GABA-A subtype-selective receptor modulators for the treatment of anxiety. Acta Pharmacol Sin 2019, 40: 571–582

Ren Z, Pribiag H, Jefferson SJ, Shorey M, Fuchs T, Stellwagen D, et al. Bidirectional homeostatic regulation of a depression-related brain state by gamma-aminobutyric acidergic deficits and ketamine treatment. Biol Psychiatry 2016, 80: 457–468

Kolata SM, Nakao K, Jeevakumar V, Farmer-Alroth EL, Fujita Y, Bartley AF, et al. Neuropsychiatric phenotypes produced by GABA reduction in mouse cortex and hippocampus. Neuropsychopharmacology 2018, 43: 1445–1456

Duman RS, Li N. A neurotrophic hypothesis of depression: role of synaptogenesis in the actions of NMDA receptor antagonists. Philos Trans R Soc Lond B Biol Sci 2012, 367: 2475–2484

Albert PR, Benkelfat C, Descarries L. The neurobiology of depression—revisiting the serotonin hypothesis. I. Cellular and molecular mechanisms. Philos Trans R Soc Lond B Biol Sci 2012, 367: 2378–2381

Li K, Shen S, Ji YT, Li XY, Zhang LS, Wang XD. Melatonin augments the effects of fluoxetine on depression-like behavior and hippocampal BDNF-TrkB signaling. Neurosci Bull 2018, 34: 303–311

Zhang JJ, Gao TT, Wang Y, Wang JL, Guan W, Wang YJ, et al. Andrographolide exerts significant antidepressant-like effects involving the hippocampal BDNF system in mice. Int J Neuropsychopharmacol 2019, 22: 585–600

Wang JQ, Mao L. The ERK pathway: Molecular mechanisms and treatment of depression. Mol Neurobiol 2019, 56: 6197–6205

Chiou YJ, Huang TL. Serum brain-derived neurotrophic factors in taiwanese patients with drug-naive first-episode major depressive disorder: Effects of antidepressants. Int J Neuropsychopharmacol 2017, 20: 213–218

CAS   PubMed   Google Scholar  

Youssef MM, Underwood MD, Huang YY, Hsiung SC, Liu Y, Simpson NR, et al. Association of BDNF Val66Met polymorphism and brain BDNF levels with major depression and suicide. Int J Neuropsychopharmacol 2018, 21: 528–538

Kojima M, Matsui K, Mizui T. BDNF pro-peptide: physiological mechanisms and implications for depression. Cell Tissue Res 2019, 377: 73–79

Jeon SW, Kim YK. Inflammation-induced depression: Its pathophysiology and therapeutic implications. J Neuroimmunol 2017, 313: 92–98

Miller AH, Raison CL. The role of inflammation in depression: from evolutionary imperative to modern treatment target. Nat Rev Immunol 2016, 16: 22–34

Zhao G, Liu X. Neuroimmune advance in depressive disorder. Adv Exp Med Biol 2019, 1180: 85–98

Li Z, Wang Z, Zhang C, Chen J, Su Y, Huang J, et al. Reduced ENA78 levels as novel biomarker for major depressive disorder and venlafaxine efficiency: Result from a prospective longitudinal study. Psychoneuroendocrinology 2017, 81: 113–121

Ambrosio G, Kaufmann FN, Manosso L, Platt N, Ghisleni G, Rodrigues ALS, et al. Depression and peripheral inflammatory profile of patients with obesity. Psychoneuroendocrinology 2018, 91: 132–141

Mao R, Zhang C, Chen J, Zhao G, Zhou R, Wang F, et al. Different levels of pro- and anti-inflammatory cytokines in patients with unipolar and bipolar depression. J Affect Disord 2018, 237: 65–72

Enache D, Pariante CM, Mondelli V. Markers of central inflammation in major depressive disorder: A systematic review and meta-analysis of studies examining cerebrospinal fluid, positron emission tomography and post-mortem brain tissue. Brain Behav Immun 2019, 81: 24–40

Haroon E, Daguanno AW, Woolwine BJ, Goldsmith DR, Baer WM, Wommack EC, et al. Antidepressant treatment resistance is associated with increased inflammatory markers in patients with major depressive disorder. Psychoneuroendocrinology 2018, 95: 43–49

Syed SA, Beurel E, Loewenstein DA, Lowell JA, Craighead WE, Dunlop BW, et al. Defective inflammatory pathways in never-treated depressed patients are associated with poor treatment response. Neuron 2018, 99(914–924): e913

Li Z, Qi D, Chen J, Zhang C, Yi Z, Yuan C, et al. Venlafaxine inhibits the upregulation of plasma tumor necrosis factor-alpha (TNF-alpha) in the Chinese patients with major depressive disorder: a prospective longitudinal study. Psychoneuroendocrinology 2013, 38: 107–114

Kohler CA, Freitas TH, Stubbs B, Maes M, Solmi M, Veronese N, et al. Peripheral alterations in cytokine and chemokine levels after antidepressant drug treatment for major depressive disorder: systematic review and meta-analysis. Mol Neurobiol 2018, 55: 4195–4206

Innes S, Pariante CM, Borsini A. Microglial-driven changes in synaptic plasticity: A possible role in major depressive disorder. Psychoneuroendocrinology 2019, 102: 236–247

Sochocka M, Diniz BS, Leszek J. Inflammatory response in the CNS: Friend or foe? Mol Neurobiol 2017, 54: 8071–8089

Zhang L, Zhang J, You Z. Switching of the microglial activation phenotype is a possible treatment for depression disorder. Front Cell Neurosci 2018, 12: 306

Sandhu KV, Sherwin E, Schellekens H, Stanton C, Dinan TG, Cryan JF. Feeding the microbiota-gut-brain axis: diet, microbiome, and neuropsychiatry. Transl Res 2017, 179: 223–244

Gonzalez-Arancibia C, Urrutia-Pinones J, Illanes-Gonzalez J, Martinez-Pinto J, Sotomayor-Zarate R, Julio-Pieper M, et al. Do your gut microbes affect your brain dopamine? Psychopharmacology (Berl) 2019, 236: 1611–1622

Article   CAS   Google Scholar  

Kennedy PJ, Cryan JF, Dinan TG, Clarke G. Irritable bowel syndrome: a microbiome-gut-brain axis disorder? World J Gastroenterol 2014, 20: 14105–14125

Whitehead WE, Palsson O, Jones KR. Systematic review of the comorbidity of irritable bowel syndrome with other disorders: what are the causes and implications? Gastroenterology 2002, 122: 1140–1156

Ruepert L, Quartero AO, de Wit NJ, van der Heijden GJ, Rubin G, Muris JW. Bulking agents, antispasmodics and antidepressants for the treatment of irritable bowel syndrome. Cochrane Database Syst Rev 2011: CD003460.

Marin IA, Goertz JE, Ren T, Rich SS, Onengut-Gumuscu S, Farber E, et al. Microbiota alteration is associated with the development of stress-induced despair behavior. Sci Rep 2017, 7: 43859

Zheng P, Zeng B, Zhou C, Liu M, Fang Z, Xu X, et al. Gut microbiome remodeling induces depressive-like behaviors through a pathway mediated by the host’s metabolism. Mol Psychiatry 2016, 21: 786–796

Curtis K, Stewart CJ, Robinson M, Molfese DL, Gosnell SN, Kosten TR, et al. Insular resting state functional connectivity is associated with gut microbiota diversity. Eur J Neurosci 2019, 50: 2446–2452

O’Mahony SM, Marchesi JR, Scully P, Codling C, Ceolho AM, Quigley EM, et al. Early life stress alters behavior, immunity, and microbiota in rats: implications for irritable bowel syndrome and psychiatric illnesses. Biol Psychiatry 2009, 65: 263–267

Garcia-Rodenas CL, Bergonzelli GE, Nutten S, Schumann A, Cherbut C, Turini M, et al. Nutritional approach to restore impaired intestinal barrier function and growth after neonatal stress in rats. J Pediatr Gastroenterol Nutr 2006, 43: 16–24

Hao Z, Wang W, Guo R, Liu H. Faecalibacterium prausnitzii (ATCC 27766) has preventive and therapeutic effects on chronic unpredictable mild stress-induced depression-like and anxiety-like behavior in rats. Psychoneuroendocrinology 2019, 104: 132–142

Messaoudi M, Violle N, Bisson JF, Desor D, Javelot H, Rougeot C. Beneficial psychological effects of a probiotic formulation (Lactobacillus helveticus R0052 and Bifidobacterium longum R0175) in healthy human volunteers. Gut Microbes 2011, 2: 256–261

Rudzki L, Ostrowska L, Pawlak D, Malus A, Pawlak K, Waszkiewicz N, et al. Probiotic Lactobacillus Plantarum 299v decreases kynurenine concentration and improves cognitive functions in patients with major depression: A double-blind, randomized, placebo controlled study. Psychoneuroendocrinology 2019, 100: 213–222

Foster JA, McVey Neufeld KA. Gut-brain axis: how the microbiome influences anxiety and depression. Trends Neurosci 2013, 36: 305–312

Mittal R, Debs LH, Patel AP, Nguyen D, Patel K, O’Connor G, et al. Neurotransmitters: The critical modulators regulating gut-brain axis. J Cell Physiol 2017, 232: 2359–2372

Diviccaro S, Giatti S, Borgo F, Barcella M, Borghi E, Trejo JL, et al. Treatment of male rats with finasteride, an inhibitor of 5alpha-reductase enzyme, induces long-lasting effects on depressive-like behavior, hippocampal neurogenesis, neuroinflammation and gut microbiota composition. Psychoneuroendocrinology 2019, 99: 206–215

Kiecolt-Glaser JK, Wilson SJ, Bailey ML, Andridge R, Peng J, Jaremka LM, et al. Marital distress, depression, and a leaky gut: Translocation of bacterial endotoxin as a pathway to inflammation. Psychoneuroendocrinology 2018, 98: 52–60

Lindqvist D, Dhabhar FS, James SJ, Hough CM, Jain FA, Bersani FS, et al. Oxidative stress, inflammation and treatment response in major depression. Psychoneuroendocrinology 2017, 76: 197–205

Czarny P, Wigner P, Galecki P, Sliwinski T. The interplay between inflammation, oxidative stress, DNA damage, DNA repair and mitochondrial dysfunction in depression. Prog Neuropsychopharmacol Biol Psychiatry 2018, 80: 309–321

Xie X, Yu C, Zhou J, Xiao Q, Shen Q, Xiong Z, et al. Nicotinamide mononucleotide ameliorates the depression-like behaviors and is associated with attenuating the disruption of mitochondrial bioenergetics in depressed mice. J Affect Disord 2020, 263: 166–174

Wang XL, Yuan K, Zhang W, Li SX, Gao GF, Lu L. Regulation of circadian genes by the MAPK pathway: Implications for rapid antidepressant action. Neurosci Bull 2020, 36: 66–76

Xie X, Shen Q, Yu C, Xiao Q, Zhou J, Xiong Z, et al. Depression-like behaviors are accompanied by disrupted mitochondrial energy metabolism in chronic corticosterone-induced mice. J Steroid Biochem Mol Biol 2020, 200: 105607

Zhang LF, Shi L, Liu H, Meng FT, Liu YJ, Wu HM, et al. Increased hippocampal tau phosphorylation and axonal mitochondrial transport in a mouse model of chronic stress. Int J Neuropsychopharmacol 2012, 15: 337–348

Flint J, Kendler KS. The genetics of major depression. Neuron 2014, 81: 1214

Sullivan PF, de Geus EJ, Willemsen G, James MR, Smit JH, Zandbelt T, et al. Genome-wide association for major depressive disorder: a possible role for the presynaptic protein piccolo. Mol Psychiatry 2009, 14: 359–375

Dunn EC, Brown RC, Dai Y, Rosand J, Nugent NR, Amstadter AB, et al. Genetic determinants of depression: recent findings and future directions. Harv Rev Psychiatry 2015, 23: 1–18

Major Depressive Disorder Working Group of the Psychiatric GC, Ripke S, Wray NR, Lewis CM, Hamilton SP, Weissman MM, et al. A mega-analysis of genome-wide association studies for major depressive disorder. Mol Psychiatry 2013, 18: 497–511.

Levinson DF, Mostafavi S, Milaneschi Y, Rivera M, Ripke S, Wray NR, et al. Genetic studies of major depressive disorder: why are there no genome-wide association study findings and what can we do about it? Biol Psychiatry 2014, 76: 510–512

Sullivan PF, Agrawal A, Bulik CM, Andreassen OA, Borglum AD, Breen G, et al. Psychiatric genomics: An update and an agenda. Am J Psychiatry 2018, 175: 15–27

Schwabe I, Milaneschi Y, Gerring Z, Sullivan PF, Schulte E, Suppli NP, et al. Unraveling the genetic architecture of major depressive disorder: merits and pitfalls of the approaches used in genome-wide association studies. Psychol Med 2019, 49: 2646–2656

Okbay A, Baselmans BM, De Neve JE, Turley P, Nivard MG, Fontana MA, et al. Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses. Nat Genet 2016, 48: 624–633

Wray NR, Ripke S, Mattheisen M, Trzaskowski M, Byrne EM, Abdellaoui A, et al. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression. Nat Genet 2018, 50: 668–681

Howard DM, Adams MJ, Clarke TK, Hafferty JD, Gibson J, Shirali M, et al. Genome-wide meta-analysis of depression identifies 102 independent variants and highlights the importance of the prefrontal brain regions. Nat Neurosci 2019, 22: 343–352

Ormel J, Hartman CA, Snieder H. The genetics of depression: successful genome-wide association studies introduce new challenges. Transl Psychiatry 2019, 9: 114

Uchida S, Yamagata H, Seki T, Watanabe Y. Epigenetic mechanisms of major depression: Targeting neuronal plasticity. Psychiatry Clin Neurosci 2018, 72: 212–227

Yeshurun S, Hannan AJ. Transgenerational epigenetic influences of paternal environmental exposures on brain function and predisposition to psychiatric disorders. Mol Psychiatry 2019, 24: 536–548

van Eijndhoven P, van Wingen G, Katzenbauer M, Groen W, Tepest R, Fernandez G, et al. Paralimbic cortical thickness in first-episode depression: evidence for trait-related differences in mood regulation. Am J Psychiatry 2013, 170: 1477–1486

Peng W, Chen Z, Yin L, Jia Z, Gong Q. Essential brain structural alterations in major depressive disorder: A voxel-wise meta-analysis on first episode, medication-naive patients. J Affect Disord 2016, 199: 114–123

Geerlings MI, Gerritsen L. Late-life depression, hippocampal volumes, and hypothalamic-pituitary-adrenal axis regulation: A systematic review and meta-analysis. Biol Psychiatry 2017, 82: 339–350

Maller JJ, Broadhouse K, Rush AJ, Gordon E, Koslow S, Grieve SM. Increased hippocampal tail volume predicts depression status and remission to anti-depressant medications in major depression. Mol Psychiatry 2018, 23: 1737–1744

Joshi SH, Espinoza RT, Pirnia T, Shi J, Wang Y, Ayers B, et al. Structural plasticity of the hippocampus and amygdala induced by electroconvulsive therapy in major depression. Biol Psychiatry 2016, 79: 282–292

Gryglewski G, Baldinger-Melich P, Seiger R, Godbersen GM, Michenthaler P, Klobl M, et al. Structural changes in amygdala nuclei, hippocampal subfields and cortical thickness following electroconvulsive therapy in treatment-resistant depression: longitudinal analysis. Br J Psychiatry 2019, 214: 159–167

Boldrini M, Santiago AN, Hen R, Dwork AJ, Rosoklija GB, Tamir H, et al. Hippocampal granule neuron number and dentate gyrus volume in antidepressant-treated and untreated major depression. Neuropsychopharmacology 2013, 38: 1068–1077

Liang S, Wang Q, Kong X, Deng W, Yang X, Li X, et al. White matter abnormalities in major depression biotypes identified by diffusion tensor imaging. Neurosci Bull 2019, 35: 867–876

Chen G, Guo Y, Zhu H, Kuang W, Bi F, Ai H, et al. Intrinsic disruption of white matter microarchitecture in first-episode, drug-naive major depressive disorder: A voxel-based meta-analysis of diffusion tensor imaging. Prog Neuropsychopharmacol Biol Psychiatry 2017, 76: 179–187

Brakowski J, Spinelli S, Dorig N, Bosch OG, Manoliu A, Holtforth MG, et al. Resting state brain network function in major depression - Depression symptomatology, antidepressant treatment effects, future research. J Psychiatr Res 2017, 92: 147–159

Dutta A, McKie S, Downey D, Thomas E, Juhasz G, Arnone D, et al. Regional default mode network connectivity in major depressive disorder: modulation by acute intravenous citalopram. Transl Psychiatry 2019, 9: 116

Meyer BM, Rabl U, Huemer J, Bartova L, Kalcher K, Provenzano J, et al. Prefrontal networks dynamically related to recovery from major depressive disorder: a longitudinal pharmacological fMRI study. Transl Psychiatry 2019, 9: 64

Muller VI, Cieslik EC, Serbanescu I, Laird AR, Fox PT, Eickhoff SB. Altered brain activity in unipolar depression revisited: Meta-analyses of neuroimaging studies. JAMA Psychiatry 2017, 74: 47–55

Connolly CG, Ho TC, Blom EH, LeWinn KZ, Sacchet MD, Tymofiyeva O, et al. Resting-state functional connectivity of the amygdala and longitudinal changes in depression severity in adolescent depression. J Affect Disord 2017, 207: 86–94

Godlewska BR, Browning M, Norbury R, Igoumenou A, Cowen PJ, Harmer CJ. Predicting treatment response in depression: The role of anterior cingulate cortex. Int J Neuropsychopharmacol 2018, 21: 988–996

Goldstein-Piekarski AN, Staveland BR, Ball TM, Yesavage J, Korgaonkar MS, Williams LM. Intrinsic functional connectivity predicts remission on antidepressants: a randomized controlled trial to identify clinically applicable imaging biomarkers. Transl Psychiatry 2018, 8: 57

Leaver AM, Vasavada M, Joshi SH, Wade B, Woods RP, Espinoza R, et al. Mechanisms of antidepressant response to electroconvulsive therapy studied with perfusion magnetic resonance imaging. Biol Psychiatry 2019, 85: 466–476

Miskowiak KW, Macoveanu J, Jorgensen MB, Stottrup MM, Ott CV, Jensen HM, et al. Neural response after a single ECT session during retrieval of emotional self-referent words in depression: A randomized, sham-controlled fMRI study. Int J Neuropsychopharmacol 2018, 21: 226–235

Du L, Liu H, Du W, Chao F, Zhang L, Wang K, et al. Stimulated left DLPFC-nucleus accumbens functional connectivity predicts the anti-depression and anti-anxiety effects of rTMS for depression. Transl Psychiatry 2018, 7: 3

Williams LM. Defining biotypes for depression and anxiety based on large-scale circuit dysfunction: a theoretical review of the evidence and future directions for clinical translation. Depress Anxiety 2017, 34: 9–24

Williams LM. Precision psychiatry: a neural circuit taxonomy for depression and anxiety. Lancet Psychiatry 2016, 3: 472–480

Williams LM, Korgaonkar MS, Song YC, Paton R, Eagles S, Goldstein-Piekarski A, et al. Amygdala reactivity to emotional faces in the prediction of general and medication-specific responses to antidepressant treatment in the randomized iSPOT-D trial. Neuropsychopharmacology 2015, 40: 2398–2408

Hou Z, Gong L, Zhi M, Yin Y, Zhang Y, Xie C, et al. Distinctive pretreatment features of bilateral nucleus accumbens networks predict early response to antidepressants in major depressive disorder. Brain Imaging Behav 2018, 12: 1042–1052

De Crescenzo F, Ciliberto M, Menghini D, Treglia G, Ebmeier KP, Janiri L. Is (18)F-FDG-PET suitable to predict clinical response to the treatment of geriatric depression? A systematic review of PET studies. Aging Ment Health 2017, 21: 889–894

Schmaal L, Pozzi E, T CH, van Velzen LS, Veer IM, Opel N, et al. ENIGMA MDD: seven years of global neuroimaging studies of major depression through worldwide data sharing. Transl Psychiatry 2020, 10: 172.

Schmaal L, Veltman DJ, van Erp TG, Samann PG, Frodl T, Jahanshad N, et al. Subcortical brain alterations in major depressive disorder: findings from the ENIGMA Major Depressive Disorder working group. Mol Psychiatry 2016, 21: 806–812

Schmaal L, Hibar DP, Samann PG, Hall GB, Baune BT, Jahanshad N, et al. Cortical abnormalities in adults and adolescents with major depression based on brain scans from 20 cohorts worldwide in the ENIGMA Major Depressive Disorder Working Group. Mol Psychiatry 2017, 22: 900–909

Frodl T, Janowitz D, Schmaal L, Tozzi L, Dobrowolny H, Stein DJ, et al. Childhood adversity impacts on brain subcortical structures relevant to depression. J Psychiatr Res 2017, 86: 58–65

Renteria ME, Schmaal L, Hibar DP, Couvy-Duchesne B, Strike LT, Mills NT, et al. Subcortical brain structure and suicidal behaviour in major depressive disorder: a meta-analysis from the ENIGMA-MDD working group. Transl Psychiatry 2017, 7: e1116

Tozzi L, Garczarek L, Janowitz D, Stein DJ, Wittfeld K, Dobrowolny H, et al. Interactive impact of childhood maltreatment, depression, and age on cortical brain structure: mega-analytic findings from a large multi-site cohort. Psychol Med 2020, 50: 1020–1031

de Kovel CGF, Aftanas L, Aleman A, Alexander-Bloch AF, Baune BT, Brack I, et al. No alterations of brain structural asymmetry in major depressive disorder: An ENIGMA consortium analysis. Am J Psychiatry 2019, 176: 1039–1049

Ho TC, Gutman B, Pozzi E, Grabe HJ, Hosten N, Wittfeld K, et al. Subcortical shape alterations in major depressive disorder: Findings from the ENIGMA major depressive disorder working group. Hum Brain Mapp 2020.

Han LKM, Dinga R, Hahn T, Ching CRK, Eyler LT, Aftanas L, et al. Brain aging in major depressive disorder: results from the ENIGMA major depressive disorder working group. Mol Psychiatry 2020.

van Velzen LS, Kelly S, Isaev D, Aleman A, Aftanas LI, Bauer J, et al. White matter disturbances in major depressive disorder: a coordinated analysis across 20 international cohorts in the ENIGMA MDD working group. Mol Psychiatry 2020, 25: 1511–1525

Lv X, Si T, Wang G, Wang H, Liu Q, Hu C, et al. The establishment of the objective diagnostic markers and personalized medical intervention in patients with major depressive disorder: rationale and protocol. BMC Psychiatry 2016, 16: 240

Fabbri C, Hosak L, Mossner R, Giegling I, Mandelli L, Bellivier F, et al. Consensus paper of the WFSBP Task Force on Genetics: Genetics, epigenetics and gene expression markers of major depressive disorder and antidepressant response. World J Biol Psychiatry 2017, 18: 5–28

Li Z, Zhang C, Fan J, Yuan C, Huang J, Chen J, et al. Brain-derived neurotrophic factor levels and bipolar disorder in patients in their first depressive episode: 3-year prospective longitudinal study. Br J Psychiatry 2014, 205: 29–35

Gong Q, He Y. Depression, neuroimaging and connectomics: a selective overview. Biol Psychiatry 2015, 77: 223–235

Papakostas GI, Shelton RC, Kinrys G, Henry ME, Bakow BR, Lipkin SH, et al. Assessment of a multi-assay, serum-based biological diagnostic test for major depressive disorder: a pilot and replication study. Mol Psychiatry 2013, 18: 332–339

Kolovos S, Kleiboer A, Cuijpers P. Effect of psychotherapy for depression on quality of life: meta-analysis. Br J Psychiatry 2016, 209: 460–468

Park LT, Zarate CA Jr. Depression in the primary care setting. N Engl J Med 2019, 380: 559–568

Health N C C F M . Depression: The treatment and management of depression in adults (updated edition) 2010.

Qaseem A, Barry MJ, Kansagara D. Clinical Guidelines Committee of the American College of P. Nonpharmacologic versus pharmacologic treatment of adult patients with major depressive disorder: A clinical practice guideline from the american college of physicians. Ann Intern Med 2016, 164: 350–359

Dodd S, Mitchell PB, Bauer M, Yatham L, Young AH, Kennedy SH, et al. Monitoring for antidepressant-associated adverse events in the treatment of patients with major depressive disorder: An international consensus statement. World J Biol Psychiatry 2018, 19: 330–348

Cristea IA, Naudet F. US Food and Drug Administration approval of esketamine and brexanolone. Lancet Psychiatry 2019, 6: 975–977

Zheng W, Cai DB, Xiang YQ, Zheng W, Jiang WL, Sim K, et al. Adjunctive intranasal esketamine for major depressive disorder: A systematic review of randomized double-blind controlled-placebo studies. J Affect Disord 2020, 265: 63–70

Popova V, Daly EJ, Trivedi M, Cooper K, Lane R, Lim P, et al. Efficacy and safety of flexibly dosed esketamine nasal spray combined with a newly initiated oral antidepressant in treatment-resistant depression: A Randomized Double-Blind Active-Controlled Study. Am J Psychiatry 2019, 176: 428–438

Turner EH. Esketamine for treatment-resistant depression: seven concerns about efficacy and FDA approval. Lancet Psychiatry 2019, 6: 977–979

Murrough JW, Abdallah CG, Mathew SJ. Targeting glutamate signalling in depression: progress and prospects. Nat Rev Drug Discov 2017, 16: 472–486

Gill SP, Kellner CH. Clinical practice recommendations for continuation and maintenance electroconvulsive therapy for depression: Outcomes from a review of the evidence and a consensus workshop held in Australia in May 2017. J ECT 2019, 35: 14–20

McClintock SM, Reti IM, Carpenter LL, McDonald WM, Dubin M, Taylor SF, et al. Consensus recommendations for the clinical application of repetitive transcranial magnetic stimulation (rTMS) in the treatment of depression. J Clin Psychiatry 2018, 79.

Chase HW, Boudewyn MA, Carter CS, Phillips ML. Transcranial direct current stimulation: a roadmap for research, from mechanism of action to clinical implementation. Mol Psychiatry 2020, 25: 397–407

Alexander ML, Alagapan S, Lugo CE, Mellin JM, Lustenberger C, Rubinow DR, et al. Double-blind, randomized pilot clinical trial targeting alpha oscillations with transcranial alternating current stimulation (tACS) for the treatment of major depressive disorder (MDD). Transl Psychiatry 2019, 9: 106

Akhtar H, Bukhari F, Nazir M, Anwar MN, Shahzad A. Therapeutic efficacy of neurostimulation for depression: Techniques, current modalities, and future challenges. Neurosci Bull 2016, 32: 115–126

Zhou C, Zhang H, Qin Y, Tian T, Xu B, Chen J, et al. A systematic review and meta-analysis of deep brain stimulation in treatment-resistant depression. Prog Neuropsychopharmacol Biol Psychiatry 2018, 82: 224–232

Li X, Li X. The antidepressant effect of light therapy from retinal projections. Neurosci Bull 2018, 34: 359–368

Shekelle PG, Cook IA, Miake-Lye IM, Booth MS, Beroes JM, Mak S. Benefits and harms of cranial electrical stimulation for chronic painful conditions, depression, anxiety, and insomnia: A systematic review. Ann Intern Med 2018, 168: 414–421

Kessler RC. The potential of predictive analytics to provide clinical decision support in depression treatment planning. Curr Opin Psychiatry 2018, 31: 32–39

Bradley P, Shiekh M, Mehra V, Vrbicky K, Layle S, Olson MC, et al. Improved efficacy with targeted pharmacogenetic-guided treatment of patients with depression and anxiety: A randomized clinical trial demonstrating clinical utility. J Psychiatr Res 2018, 96: 100–107

Greden JF, Parikh SV, Rothschild AJ, Thase ME, Dunlop BW, DeBattista C, et al. Impact of pharmacogenomics on clinical outcomes in major depressive disorder in the GUIDED trial: A large, patient- and rater-blinded, randomized, controlled study. J Psychiatr Res 2019, 111: 59–67

Long Z, Du L, Zhao J, Wu S, Zheng Q, Lei X. Prediction on treatment improvement in depression with resting state connectivity: A coordinate-based meta-analysis. J Affect Disord 2020, 276: 62–68

Download references

Acknowledgments

This review was supported by the National Basic Research Development Program of China (2016YFC1307100), the National Natural Science Foundation of China (81930033 and 81771465; 81401127), Shanghai Key Project of Science & Technology (2018SHZDZX05), Shanghai Jiao Tong University Medical Engineering Foundation (YG2016MS48), Shanghai Jiao Tong University School of Medicine (19XJ11006), the Sanming Project of Medicine in Shenzhen Municipality (SZSM201612006), the National Key Technologies R&D Program of China (2012BAI01B04), and the Innovative Research Team of High-level Local Universities in Shanghai.

Author information

Authors and affiliations.

Clinical Research Center and Division of Mood Disorders of Shanghai Mental Health Center, Shanghai Jiao Tong University School of Medicine, Shanghai, 200030, China

Zezhi Li, Jun Chen & Yiru Fang

Department of Neurology, Ren Ji Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 200127, China

Shanghai Institute of Nutrition and Health, Shanghai Information Center for Life Sciences, Chinese Academy of Science, Shanghai, 200031, China

Meihua Ruan

Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Science, Shanghai, 200031, China

Shanghai Key Laboratory of Psychotic Disorders, Shanghai, 201108, China

Jun Chen & Yiru Fang

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Yiru Fang .

Ethics declarations

Conflicts of interest.

The authors declare no conflicts of interest.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Li, Z., Ruan, M., Chen, J. et al. Major Depressive Disorder: Advances in Neuroscience Research and Translational Applications. Neurosci. Bull. 37 , 863–880 (2021). https://doi.org/10.1007/s12264-021-00638-3

Download citation

Received : 30 May 2020

Accepted : 30 September 2020

Published : 13 February 2021

Issue Date : June 2021

DOI : https://doi.org/10.1007/s12264-021-00638-3

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Major depressive disorder
• Pathogenesis
• Find a journal
• Publish with us
• Track your research

• < Previous

Home > THESES > 10202

Breaking the Stigma: Major Depressive Disorder

Joanna Cox Follow

Major Depressive Disorder (MDD) is a mood and mental disorder affecting the brain; it is caused by the reduction of three monoamine neurotransmitters: serotonin, norepinephrine, and dopamine (Rot, M. A., Mathew, S. J., & Charney, D. S. 2009). MDD is one of the world’s most common mental disorders, affecting a predicted 4% of the world’s population and roughly 16.1 million adults in United States alone (Major Depression. 2019; Ritchie, H., & Roser, M. 2018). The concentrations of these neurotransmitters are reduced in the brains of people with MDD due to their increased reabsorption from synapses in the brain back into presynaptic neurons (Ruhé, H. G., Mason, N. S., & Schene, A. H. 2007). In attempt to regulate the concentrations of these neurotransmitters in people with MDD, medications like SSRIs, SNRIs, TCAs, and MAOIs can be prescribed (Yeragani, V., Ramachandraih, C., Subramanyam, N., Bar, K., & Baker, G. 2011). In addition to neurochemical changes, neuroanatomical changes have also been reported in people with MDD (Treadway, M. T., & Pizzagalli, D. A. 2014).

In recent years, depressive disorders have captured brief media attention due to celebrities sharing their experiences with MDD, as well as celebrities dying by suicide. Although depressive disorders are more frequently being acknowledged and discussed in a public spotlight, there remains a stigma surrounding mental illness including MDD. This partially stems from a lack of public understanding that mental disorders are, indeed, illnesses. Societal pressures may prevent people suffering from mental illnesses from accepting that they have a disorder, seeking help from medical professionals, and not being ashamed of their disorder (Corrigan, P. W., Druss, B. G., & Perlick, D. A. 2014). Furthermore, individuals that have sought help often talk to a physician or psychiatrist about their diagnosis, but they may struggle to understand the information presented to them. The purpose of this project was to create several illustrations and an animation that would strengthen public and patient education and understanding of MDD in attempt to help break some of the stigma that surrounds this mental illness.

Library of Congress Subject Headings

Depression, Mental--Interactive multimedia--Design; Depression, Mental--Treatment--Interactive multimedia--Design

Publication Date

Document type, student type, degree name.

Medical Illustration(MFA)

Department, Program, or Center

Medical Illustration (CHST)

James Perkins

Advisor/Committee Member

Craig Foster

Recipient of the 2019 Graduate Education Master of Fine Arts Thesis Award

Recommended Citation

Cox, Joanna, "Breaking the Stigma: Major Depressive Disorder" (2019). Thesis. Rochester Institute of Technology. Accessed from https://repository.rit.edu/theses/10202

RIT – Main Campus

Since August 28, 2019

Advanced Search

• Notify me via email or RSS
• Colleges and Departments
• Student Scholarship
• Faculty & Staff Scholarship
• RIT Open Access Journals
• RIT Open Access Books
• RIT Conferences

Author Corner

• RIT Open Access Publishing
• RIT Libraries

Home | About | FAQ | My Account | Accessibility Statement

Privacy Copyright

• Write my thesis
• Thesis writers
• Buy thesis papers
• Bachelor thesis
• Master's thesis
• Thesis editing services
• Thesis proofreading services
• Buy a thesis online
• Write my dissertation
• Dissertation proposal help
• Pay for dissertation
• Custom dissertation
• Dissertation help online
• Buy dissertation online
• Cheap dissertation
• Dissertation editing services
• Write my research paper
• Buy research paper online
• Pay for research paper
• Research paper help
• Order research paper
• Custom research paper
• Cheap research paper
• Research papers for sale
• Thesis subjects
• How It Works

What Is a Good Thesis Statement About Depression?

Do you need to compose an informative or an argumentative essay on depression? One of the vital parts of your paper is a thesis statement on depression. Note there are various types of thesis statements, and what you use depends on the type of essay you are writing. A thesis summarizes the concept that you write on your research paper or the bottom line that you will write in your essay. It should elaborate more on the depression topics for the research paper you are working on. But at times, you might have a hard time writing your thesis statement.

Good Thesis Statement about Teenage Depression

Bipolar disorder thesis statements about depression, interesting thesis statements about depression, interesting thesis statement about diagnosis and treatment of depression, thesis statement about stress and depression, free thesis statements about depression and anxiety, get help with your depression research paper.

Here is a list of thesis statements to have an easier time writing your essay. They cover different topics, making it easy to select what excites you. Here we go!

Are you writing about teenagers and how they are always overthinking about their future, and they end up getting depressed? You need to write a good thesis statement for a depression research paper. That will help your depression argumentative essay stand out. Here are some thesis statement for depression to check out.

• There is a link between depression and alcohol among teenagers and the various ways to control it.
• Teenagers dealing with mood disorders eat and sleep more than usual, getting less interested in regular activities.
• Mediation is an effective way to reach out to adolescents that show heightened symptoms of depression.
• Self-blaming attributions are social cognitive mechanisms among adolescents.
• Peer victimization causes high-stress levels among adolescents and has negative psychological consequences.

Choosing a good depression thesis statement on bipolar disorder can be hectic. Research on bipolar will require a good thesis statement for mental health. Choose a thesis statement about mental health awareness here.

• People with Bipolar depression have more difficulties getting quality sleep.
• Bipolar disorder influences every aspect of a person’s life and changes their quality of life.
• Bipolar disorder causes depressive moods or lows of mental disorder.
• Bipolar is a severe mental issue that can negatively impact your moods, self-esteem, and behavior.
• Psychological evaluations play a significant role in diagnosing bipolar disorder.

When writing your essay, ensure that the thesis statement for mental health is fascinating. You will impress your professors if you get the right depression research paper outline as your thesis statement. Here is a depression thesis statement you can use.

• The effects of human psychology are viewed in the form of depression.
• Clinical psychology can help to bring outpatients who have depression.
• Treating long-term depression in bipolar patients is possible.
• Bipolar patients are drained to the roots of depression.
• Well-established rehabilitation centers can help bring drug addicts from depression.

Are you thinking of writing a thesis on depression and how to treat it? If so, you need to have an excellent thesis statement about mental health that will impress your professor. Read this list to find a thesis you need for your research paper.

• There are different ways to diagnose and treat depression from its early stage.
• People who show signs of depression from an early stage and seek treatment are likely to recover instead of those who do not show early signs.
• After you receive treatment for depression, putting the right measure in place is one of the best and effective ways to ensure that you do not get it again for the second time.
• Anxiety can interfere with daily living, and it can get anyone from children to adults.
• Besides medication, you need a lifestyle change and acceptance to treat depression.

Is your research about stress and how it can impact mental health? Getting a thesis statement for depression research paper that impresses your examiners can be challenging. Choose a thesis statement for your mental illness research paper below.

• Although it is normal for various situations to cause stress, having constant stress can have detrimental effects.
• To survive the modern industrial society, you need to have stress management strategies.
• The challenges of understanding and adapting to the changing environment can lead to stress.
• Lack of proper stress management will lead to inefficiency in everything people do.
• Stress does not come unless there are underlying stressors in your life.

Our team of writers is well-conversant about a free thesis statement about anxiety you can use. The best anxiety thesis statement will help you get the best grades. Here is a list of statements that stands out:

• Many factors can lead to early anxiety, but the leading cause of anxiety in adolescents is directly linked to families.
• Anxiety is a severe mental disorder that can occur without any apparent triggers.
• Long-term depression and anxiety can impact your mental health, but you can recover if you seek treatment.
• Depression and anxiety are not interlinked, and it is essential to learn how to differentiate them on practical grounds.
• Society has a role to play in helping people come out of depression and anxiety.

How do you write a research paper about depression and how it affects mental health? Before choosing a thesis statement on mental health, have a clear understanding of the essay that you are writing. That will help you get the best thesis to make our essay stand out.

But don’t keep stressing out about your thesis statement for mental illness research paper. We have your work cut out because our skilled writers have compiled a list of thesis statements about mental health and depression topics for research paper writing. We will also suggest correct thesis statements for your essay homework or assignment.

If you are still unsure of the statement to use, get in touch with us today. We have a team of skilled and experienced writers that can help you with your essay or research project and ensure that you get the best grades.

Leave a Reply Cancel reply

ORIGINAL RESEARCH article

Multidimensional analysis of major depression: association between bdnf methylation, psychosocial and cognitive domains.

• 1 Centro de Investigaciones Genéticas en Enfermedades Humanas, Departamento de Ciencias Biológicas, Universidad de los Andes, Bogotá, Colombia
• 2 Departamento de Psicología, Universidad de los Andes, Bogotá, Colombia
• 3 Instituto Colombiano del Sistema Nervioso, Clínica Montserrat, Bogotá, Colombia
• 4 SIGEN alianza Universidad de los Andes – Fundación Santa Fe de Bogotá, Bogotá, Colombia

Major Depression is a complex disorder with a growing incidence worldwide and multiple variables have been associated with its etiology. Nonetheless, its diagnosis is continually changing and the need to understand it from a multidimensional perspective is clear. The purpose of this study was to identify risk factors for depression in a case-control study with 100 depressive inpatients and 87 healthy controls. A multivariate logistic regression analysis was performed including psychosocial factors, cognitive maladaptive schema domains, and specific epigenetic marks (BDNF methylation levels at five CpG sites in promoter IV). A family history of depression, the cognitive schemas of impaired autonomy/performance, impaired limits, other-directedness, and the methylation level of a specific CpG site were identified as predictors. Interestingly, we found a mediating effect of those cognitive schemas in the relationship between childhood maltreatment and depression. Also, we found that depressive patients exhibited hypomethylation in a CpG site of BDNF promoter IV, which adds to the current discussion about the role of methylation in depression. We highlight that determining the methylation of a specific region of a single gene offers the possibility of accessing a highly informative an easily measurable variable, which represents benefits for diagnosis. Following complete replication and validation on larger samples, models like ours could be applicable as additional diagnostic tools in the clinical context.

Introduction

Major Depressive Disorder (MDD) is a highly prevalent and vastly complex clinical condition, which requires a multidimensional approach in its study ( 1 – 4 ). Several studies have highlighted that the risk of suffering from depression is related to cognitive patterns acquired during childhood, shaping the individual's ability to cope with daily life events during adulthood ( 5 – 9 ). In this regard, early environmental conditions, including maltreatment and a family history of depression, have been linked to the disorder ( 10 , 11 ). There is also evidence of the mediating role of cognitive factors in the relationship between childhood maltreatment and subsequent adult psychopathology, including higher risk of developing depression ( 12 – 14 ).

Negative affective biases related to early life adversity (ELA) can increase the risk of developing MDD, which is known as the cognitive diathesis-stress model of depression ( 15 ). This cognitive model suggests that the negative attributional processes that the individual activates against life events are associated with the development of depressive symptomatology ( 16 – 18 ). Besides, the theory of early maladaptive schema (EMS) domains emphasizes the role of the cognitive dimension in the developing psychopathology, asserting that some patterns and tendencies acquired during childhood can represent an additional risk of suffering some kind of mental disorder ( 19 , 20 ). EMS has been defined as pervasive and dysfunctional beliefs about the self and the relationship with others, which are classified into five domains: “Disconnection and Rejection” (DR), “Impaired Autonomy and Performance” (IAP), “Impaired Limits” (IL), “Other-directedness” (OD), and “Overvigilance and Inhibition” (OIN) ( 19 , 21 ). There is a well-established link between developing EMS and the impossibility of satisfying psychological needs, such as manifesting autonomy or secure attachment, which is also related to parental care ( 12 ). For this point, there is evidence suggesting that individuals whose families have a history of depression are more likely to develop the disorder, given that they are exposed to adverse conditions created in the familiar context ( 22 ).

Biological mechanisms—epigenetics, for example—have been identified as crucial mediators of psychosocial factors and subsequent emerging risk for mental illness ( 23 ). The analysis of epigenetic marks associated with depression seems to be a promising path for the study of MDD. However, not all studies have shown differences in the methylation levels between depressive patients and controls ( 24 – 26 ), and there have been conflicting results, with either increased or decreased methylation within the promoter regions and its role in the pathogenesis of affective disorders ( 27 – 29 ). The methylation level within the brain-derived neurotrophic factor (BDNF, Gene ID: 627) has been one of the most studied epigenetic marks since this gene codes for a neurotrophin involved in the development and functioning of the nervous system, especially in neuronal growth, proliferation, and survival ( 25 , 30 , 31 ). The BDNF exon IV promoter region has been of particular interest as it is critical for activity-dependent transcription and includes several CpG sites liable to methylate ( 26 , 27 , 32 ). Despite these contrasting findings when reporting BDNF methylation in MDD, what seems clear is that ELA, including childhood maltreatment and neglect, is a key predictor for major depressive disorder, as it has been found to epigenetically affect critical behavioral systems ( 33 ).

The multidimensional nature of the disorder, and its wide phenotype spectrum has supposed a challenge for diagnosis. It has been reported that general practitioners correctly identify depression in about half of the cases. The rate of accurate diagnosis through clinical measurements has a wide variation between countries, with over-detection (false positives) as a latent problem ( 34 ), a situation that increase the need to further elucidate the nature of the disorder. Thus, this study intended to determine which psychosocial and cognitive variables (including early life adversity and maladaptive schema domains) and epigenetic marks (BDNF methylation levels at five CpG sites in promoter IV) could be useful to establish a multivariate model to differentiate individuals diagnosed with MDD from healthy controls.

Study Design and Subjects

A case-control study was performed to identify associations between Major Depressive Disorder and psychosocial (childhood adversity, early maladaptive schema domains and family history of depression), epigenetic (BDNF methylation levels at five CpG sites in promoter IV), and socio-demographic variables. Inpatients were recruited from two psychiatric hospitals in Bogotá. All of them had a primary diagnosis of MDD according to the ICD-10 criteria ( 35 ), and confirmed by the MINI structured interview for DSM-IV ( 36 ). Other inclusion criteria for the cases were that they had to be over 18 years of age and have at least completed elementary school (to guarantee the understanding of the measuring instruments). Exclusion criteria included: bipolar depression, comorbidity with substance abuse or dependence, psychotic disorders, dementia, and/or delirium. The control group was made up of healthy participants, recruited via a screening procedure from the general population. The following inclusion criteria were considered for the controls: individuals without past or present MDD diagnosis, subjects aged least 18, with completed elementary school. Exclusion criteria for the control group included the diagnosis of any psychiatric condition (addiction, bipolar disorder, organic mental disorder, psychotic disorder) and family relationship with a case subject. The collection of the sample was non-probabilistic for convenience. The participant flow diagram is presented in the Supplementary Figure 1 .

Psychological Measures

Each participant completed the following standardized questionnaires.

A personal questionnaire consisting in a clinical research interview designed to assess family and personal risk factors, including information about physical or psychological early maltreatment or neglect, as well as any family history of depression.

A Mini-International Neuropsychiatric Interview ( 36 ), which is a structured diagnostic interview considered a gold standard to confirm inclusion criteria for all eligible patients and rule out mental disorders from controls.

A Schema Questionnaire-Short Form (YSQ-SF) ( 37 ), which assesses the maladaptive schemas proposed by Young ( 38 ) and was used to evaluate the presence of cognitive maladaptive schemas in the participants. Participants graded each of the 75 items of the test, providing a score between 1 (does not fit) and 6 (perfect fit), with higher scores indicating greater maladaptive schemas (Cronbach's alpha 0.82).

Molecular Analysis

After psychological measures were completed, a blood sample was obtained from each individual to perform molecular analysis. The DNA was isolated from leukocytes with the DNA 2,000 kit (Corpogen) and its concentration was determined with a NanoDrop (Thermo Scientific) spectrophotometer. Four hundred nanograms of the DNA were used for bisulfite conversion according to the manufacturer's protocol (EZ DNA Methylation Gold Kit; Zymo Research, CA, USA). The PCR reactions were carried out in a total volume of 20 μl using 1 μl mmol of each primer, 10 μl of GoTaq Hot Start Master Mix (Promega, USA), and 10 μl of nucleotides-free water. We used primers to amplify the region of interest, independently of the methylation status: 5′- TGATTTTGGTAATTNGTGTATT−3′ and 5′- CTCCTTCTATTCTACAACAAAAAA−3′. The amplification protocol involved a denaturation cycle (5 min, 95°C), 45 cycles of denaturation (1 min, 95°C), annealing (45 s, 57°C), and extension (1 min, 72°C), followed by a final extension cycle (5 min, 72°C) terminating at 4°C. PCR products were separated onto 2% agarose gel to verify the amplification of the region of interest.

The five CpG sites targeted in our analysis encompass a 66 bp BDNF promoter IV region ( Figure 1 ). We assessed the methylation levels of the CpG positions through direct sequencing of bisulfite-treated DNA (BSP).

Figure 1 . BDNF promoter IV region evaluated in this study (chr11: 27,701,519-27,701,826 UCSC Genome Browser Human GRCh38/hg38 Assembly).

The amplified fragment was sequenced by Sanger's method at the university sequencing center. DNA methylation percentages were measured using ESME (Epigenetic Sequencing Methylation Software) ( 39 ), which performs a quantitative estimate with a specific algorithm that normalizes the signal of the sequencing, corrects incomplete conversion problems, and neutralizes possible artifacts in the nucleotide signals.

Population substructure analysis was assessed by 46 ancestry informative markers (AIMs) according to the protocol described by Pereira et al. ( 40 ). The PCR products were prepared for posterior capillary electrophoresis ( 41 ) and then analyzed for genotyping with GeneMapper ( 42 ). The differences in the ancestry proportions between patients and controls were estimated using STRUCTURE ( 43 ).

Statistical Analysis

Statistical analysis was conducted using RStudio ( 44 ). A significance level of 5% was used for all analyses. Fisher's exact tests and T -test were used to determine group differences for sociodemographic variables. Univariate logistic regression analyses (including age and gender as covariates) were first performed for the psychosocial, cognitive, and epigenetic features to identify associations with MDD. Next, a multivariate logistic regression was conducted including the features with a p value of < 0.05 in the univariate analysis. This model also included age and gender as covariates. The factors with a p value of 0.05 or less in the multivariate analysis were identified to be significantly correlated with MDD. Variance Inflation Factor (VIF) was used to determine the multicollinearity of the data within the model. A causal mediation analysis was carried out to test the hypothesis that the cognitive domains significantly associated with MDD act as mediating factors between childhood maltreatment and the probability of developing depression. Considering the limited sample-set size, a 10-fold cross validation strategy with 100-round classifications was used to evaluate the performance of the model. Training was performed using 80% of the total data set and testing was performed with the remaining 20% ( 45 ).

The study protocol and informed consent were approved by the Institutional Ethics Committee of each institution. Prior to any procedure, written informed consent was obtained from all participants, in agreement with the Declaration of Helsinki.

Participant Characteristics

A total of 100 inpatients clinically diagnosed with major depression and 87 healthy controls were recruited for the study. Demographic characteristics and ancestry information of the participants are presented in Table 1 . Our sample was initially paired by gender. However, after removing some control samples that did not meet the quality criteria for the methylation analysis, this match was lost.

Table 1 . Demographic characteristics and population substructure of participants.

Univariate Analyses

Univariate logistic regression analyses showed that having a family history of depression, the exposure to childhood adversity, higher scores for cognitive schemas, as well as the methylation level of three CpG sites are significantly associated with depression ( Supplementary Table 1 ).

Risk Factors for Depression

The features that showed a p value of < 0.05 in the univariate analysis were included in the multivariate logistic regression model. This analysis was adjusted by age and gender and yielded a model according to which a family history of depression, the early maladaptive schema domains of impaired autonomy/performance, impaired limits and other-directedness showed a strong association to MDD. The schema domain of disconnection/rejection almost reached statistical significance ( p = 0.054). Regarding methylation, the multivariate analysis revealed that only one CpG site (BDNF IV CpG3: Chr11: 27723204-CRCh37/hg19) was related to the disorder ( Table 2 ).

Table 2 . Results of the multivariate logistic regression analysis.

Considering the five variables that are significantly associated with MDD, we formulated the following logistic regression equation: logit (D) = ln (D/1-D) = −12.37 + 2.54X 1 + 0.40X 2 + 0.19X 3 + 0.16X 4 + (−0.08X 5 ) (D: probability of predicting MDD [0–1], X 1 : family history of depression [yes, no], X 2 : IAP-Domain [continuous score], X 3 : IL-Domain [continuous score], X 4 : OD-Domain [continuous score], X 5 : Methylation level at CpG3 [percentage]. Of the five factors, only the methylation level at CpG3 exhibited a negative association with the disorder, this being hypomethylated in patients compared to controls.

Tests to determine whether the data met the assumption of collinearity indicated that multicollinearity was not a concern in the resulting model (VIF <5). The 10-fold cross validation analysis showed that our model has an accuracy of 86% (95% CI: 0.71–0.95, p < 0.001), a sensitivity (true positive rate) of 90% and a specificity (true negative rate) of 81% (Kappa = 0.72).

Moderation Analysis

The causal mediation analysis showed that the additive score of the cognitive schemas of impaired autonomy/performance, impaired limits and other-directedness acts as a mediating variable between childhood maltreatment and the probability of being diagnosed with major depression (Prop. Mediated = 68%, 95% CI: 0.09–0.29, p < 0.0001). The estimated average of the mediating effect is represented in Figure 2 .

Figure 2 . Effect of childhood maltreatment on likelihood of MDD through cognitive schemas. Causal mediation analysis results. ACME stands for average causal mediation effects of childhood maltreatment on the likelihood of MDD through the cognitive schemas; ADE stands for average direct effects of childhood maltreatment on the likelihood of MDD; Total effect stands for the total effects (direct and indirect) of childhood maltreatment on the likelihood of MDD.

A multifactorial logistic model was evaluated in the present study, including psychosocial, cognitive, and epigenetic factors associated with MDD. Regarding the family history of depression, recent evidence reports that familial risk increases the probability of individual lifetime depression ( 22 , 46 ). Although it has been argued that the transgenerational effect of family risk may have a genetic background ( 47 ), the disorder's low heritability has encouraged the exploration of other hypotheses. It seems that familial risk has a strong link with early adverse conditions since high-risk families are more likely to experience a more significant number of challenging situations, which predicts the development of more severe depression ( 48 ). Concerning early adversity, there is a large body of evidence that experiencing abuse or maltreatment during childhood accounts as a risk factor in the development of psychopathology during adulthood ( 11 , 49 ). The multivariate logistic regression in this study did not reveal a significant association between childhood maltreatment and MDD. This is explained by the mediating effect that we found of the cognitive schemas in the relationship of childhood adversity and the likelihood of depression. This finding is consistent across different studies confirming that cognitive factors could act as mediators between early maltreatment and the subsequent risk of developing psychopathologies ( 13 , 14 ). This is comprehensible since, according to schema therapy ( 19 ), neglected children are at risk of developing EMS. Besides, some authors have pointed out that childhood adversity can indirectly predict depression through cognitive vulnerabilities, including dysfunctional schemas ( 50 ).

Additional evidence supporting the previous hypothesis states that the schema domains of impaired autonomy/performance and disconnection/rejection mediate the relationship between childhood maltreatment and depression ( 51 ). It is also consistent with prior research establishing that maladaptive schemas of impaired autonomy/performance, impaired limits and other-directedness have a strong association with MDD ( 5 , 52 – 55 ). Schemas represent a cognitive dimension, which seems highly stable over time in depressed patients ( 20 ). Impaired autonomy and performance are related to the inability to cope in everyday life, which affects the individual in many dimensions, involving dependence and an underdeveloped self ( 21 ). Not surprisingly, it has been reported that the reduction of depressive symptoms in patients under treatment was strongly associated with a reduction in the punctuation of this schema ( 56 ). Impaired limits involve difficulties in setting internal limits, assuming responsibility or even setting long-term goals ( 57 ) and it have been identified as a predictor of depression severity ( 58 ). The other-directedness EMS implies subjugation, self-sacrifice and constant seeking for recognition, as well as a tendency to respect other's desires at the expense of one's own needs ( 57 ). This domain has also been highlighted for its relation with depressive symptoms ( 59 ) as well as for its mediating role between co-rumination and depression ( 60 ).

One of the biological processes underlying the etiology of major depression is epigenetics, which comprises molecular mechanisms, like DNA methylation, that modulate gene expression in response to extrinsic or intrinsic signals ( 61 ). In this study, we evaluated the methylation level at specific CpG sites in BDNF promoter IV. The brain-derived neurotrophic factor is a neurotrophin that has been widely associated with major depressive disorder since abnormalities in its expression produce dysfunction in circuits that compromise emotional and cognitive functions ( 24 , 62 , 63 ). Our association results for the CpG3 site in BDNF promoter IV suggest that individuals with elevated methylation levels are less likely to show a depressive phenotype. This finding contrasts with prior research establishing that individuals with depression have lower levels of BDNF than healthy controls ( 64 , 65 ) which, hypothetically, would be related to higher levels of methylation in patients. However, results concerning the methylation of BDNF and its role in depression have been ambiguous. There is evidence showing higher methylation in some CpG regions of BDNF promoters I and IV of depressed patients than healthy controls ( 64 ), highlighting childhood adversity as a mediating factor of these differences ( 65 ). In contrast, other authors report that those regions can appear as either hypomethylated or hypermethylated in clinical populations ( 66 ). A study involving mothers and their newborns revealed that prenatal depressive symptoms predicted decreased BDNF IV DNA methylation in infants ( 28 ). Specifically, they found hypomethylation at the same CpG site assessed in the present study in newborns who were prenatally exposed to maternal stress compared to controls.

The differences found within that specific CpG site could imply changes in BDNF mRNA and protein expression since it is adjacent to the binding site for the transcription factor CREB (cAMP response element-binding), which modulates gene transcription via a DNA methylation-dependent mechanism ( 67 , 68 ). Another study demonstrates that healthy individuals with a family history of depression exhibited higher peripheral BDNF levels ( 69 ), presumably suggesting hypomethylation in those individuals with higher familial risk. There is also evidence of DNA hypomethylation in fragments of BDNF IV in patients who have schizophrenia compared to controls ( 70 ).

It is important to note that CpG3 includes binding sites for the glucocorticoid receptor (GR), as shown on the PROMO platform ( 71 ). This gene is one of the most important for regulating the stress response through the Hypothalamic-Pituitary-Adrenal (HPA) axis and modulation of peripheral cortisol levels. Concerning depression, it has been shown that there is an alteration in the sensitivity of the GR, which causes control failure in the cortisol levels after activation of the HPA axis ( 72 ). Likewise, certain antidepressants directly affect glucocorticoid receptors, increasing their functionality and expression ( 73 ).

Our model underscores the importance of the individual's cognitive dimension and the echoes that it can produce at specific epigenetic marks to understand the depressive disorder better. Accordingly, to consider a complex disorder like major depression, we need a powerful kaleidoscope of factors that can help us to understand fractions and to gain a general perspective of a condition that involves many biological systems and, therefore, affects the individual in multiple dimensions in their daily life. Altogether, the results of our study suggest that a model including psychosocial, cognitive, and epigenetic factors could help differentiate depressive patients from healthy controls and, therefore, could contribute to clinical diagnosis. Indeed, it has been highlighted that biological and cognitive measurements will be crucial, beyond traditional symptom-based diagnosis, to subtyping and redefining psychiatric disorders ( 3 , 74 ). Additionally, the inclusion of a biological variable, like DNA methylation of a critical gene previously related to depression, is an essential step toward future strategies for treatment and prevention. In the future, it would be benefit to explore association with other approaches, such as the endophenotypes described for depression and anxiety ( 75 ), including variables related to Behavioral Activation System (BAS) and Behavioral Inhibition System (BIS), which can act as moderators between depressive symptoms and live events ( 76 ). Also, adding functional analysis to clarify the effect of the methylation level at BDNF promoter IV, as well as testing the proposed model in samples from different populations could be very useful in future studies.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon request.

Ethics Statement

The studies involving human participants were reviewed and approved by Ethics Committees of the University of the Andes and the Montserrat clinic. The patients/participants provided their written informed consent to participate in this study.

Author Contributions

MV, YG-M, EF, and ML: conceived and designed the research. MV, YG-M, EF, and WC: collected the data. MV, YG-M, SG-N, and WC: performed the analysis. MV, YG-M, EF, SG-N, and ML: wrote the paper. All authors contributed to the article and approved the submitted version.

This study was financed by the faculty of sciences, the vice-rectorate research of the University of los Andes and by a research grant (712.2015/908/120471250970) from Minciencias. They provided resources, but did not actively participate in any stage of the research.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher's Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Acknowledgments

We thank Minciencias, Universidad de los Andes, and the psychiatric institutions involved in the study. We are very grateful to the patients and people who participated in this research, voluntarily and selflessly. We also want to thank Juan Felipe Cardona Londoño, for the careful review of the manuscript and feedback.

Supplementary Material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpsyt.2021.768680/full#supplementary-material

1. Belmaker RH, Agam G. Major depressive disorder. N Engl J Med. (2008) 358:55–68. doi: 10.1056/NEJMra073096

PubMed Abstract | CrossRef Full Text | Google Scholar

2. Read JR, Sharpe L, Modini M, Dear BF. Multimorbidity and depression: a systematic review and meta-analysis. J Affect Disord. (2017) 221:36–46. doi: 10.1016/j.jad.2017.06.009

3. Insel T, Cuthbert B, Garvey M, Heinssen R, Pine DS, Quinn K, et al. Research Domain Criteria (RDoC): toward a new classification framework for research on mental disorders. Am J Psychiatry. (2010) 167:748–51. doi: 10.1176/appi.ajp.2010.09091379

4. Arango C, Díaz-Caneja CM, McGorry PD, Rapoport J, Sommer IE, Vorstman JA, et al. Preventive strategies for mental health. Lancet Psychiatry. (2018) 5:591–604. doi: 10.1016/S2215-0366(18)30057-9

5. Renner F, Lobbestael J, Peeters F, Arntz A, Huibers M. Early maladaptive schemas in depressed patients: stability and relation with depressive symptoms over the course of treatment. J Affect Disord. (2012) 136:581–90. doi: 10.1016/j.jad.2011.10.027

6. Beck AT, Bredemeier K. A unified model of depression. Clin Psychol Sci. (2016) 4:596–619. doi: 10.1177/2167702616628523

CrossRef Full Text | Google Scholar

7. Badcock PB, Davey CG, Whittle S, Allen NB, Friston KJ. The depressed brain: an evolutionary systems theory. Trends Cogn Sci. (2017) 21:182–94. doi: 10.1016/j.tics.2017.01.005

8. Nestler EJ, Barrot M, DiLeone RJ, Eisch AJ, Gold SJ, Monteggia LM. Neurobiology of depression. Neuron. (2002) 34:13–25. doi: 10.1016/S0896-6273(02)00653-0

9. Krishnan V, Nestler EJ. The molecular neurobiology of depression. Nature. (2008) 455:894–902. doi: 10.1038/nature07455

10. Kruijt AW, Antypa N, Booij L, de Jong PJ, Glashouwer K, Penninx BWJH, et al. Cognitive reactivity, implicit associations, and the incidence of depression: a two-year prospective study. PLoS ONE. (2013) 8:e70245. doi: 10.1371/journal.pone.0070245

11. Liu RT. Childhood adversities and depression in adulthood: current findings and future directions. Clin Psychol Sci Pract. (2017) 24:140–53. doi: 10.1111/cpsp.12190

12. Rezaei M, Ghazanfari F, Rezaee F. The role of childhood trauma, early maladaptive schemas, emotional schemas and experimental avoidance on depression: a structural equation modeling. Psychiatry Res. (2016) 246:407–14. doi: 10.1016/j.psychres.2016.10.037

13. Aafjes-Van Doorn K, Kamsteeg C, Silberschatz G. Cognitive mediators of the relationship between adverse childhood experiences and adult psychopathology: a systematic review. Dev Psychopathol. (2020) 32:1017–29. doi: 10.1017/S0954579419001317

14. McGinn LK, Cukor D, Sanderson WC. The relationship between parenting style, cognitive style, and anxiety and depression: does increased early adversity influence symptom severity through the mediating role of cognitive style? Cogn Ther Res. (2005) 29:219–42. doi: 10.1007/s10608-005-3166-1

15. Abramson LY, Alloy LB, Hankin BL, Haeffel GJ, MacCoon DG, Gibb BE. Cognitive vulnerability-stress models of depression in a self-regulatory and psychobiological context. Handb Depress. (2002) 268–94.

Google Scholar

16. Soria M, Otamendi A, Berrocal C, Caño A, Naranjo CR. Las atribuciones de incontrolabilidad en el origen de las expectativas de desesperanza en adolescentes. Psicothema. (2004) 16:476–80.

17. Sanjuán P, Magallanes A. Estilos explicativos y estrategias de afrontamiento. Clínica y Salud . (2007) 18:83–98.

18. Gómez Maquet Y, Ángel JD, Cañizares C, Lattig MC, Agudelo DM, Arenas Á, et al. The role of stressful life events appraisal in major depressive disorder. Rev Colomb Psiquiatr . (2018) 49:68–75. doi: 10.1016/j.rcp.2018.07.004

19. Young JE, Klosko JS, Weishaar ME. Schema Therapy : A Practitioner's Guide . Guilford Press (2003).

20. Flink N, Honkalampi K, Lehto SM, Viinamäki H, Koivumaa-Honkanen H, Valkonen-Korhonen M, et al. Early maladaptive schemas in chronically depressed patients: a preliminary investigation. Clin Psychol. (2019) 23:15–25. doi: 10.1111/cp.12151

21. Haugh JA, Miceli M, DeLorme J. Maladaptive parenting, temperament, early maladaptive schemas, and depression: a moderated mediation analysis. J Psychopathol Behav Assess. (2017) 39:103–16. doi: 10.1007/s10862-016-9559-5

22. Elsayed NM, Fields KM, Olvera RL, Williamson DE. The role of familial risk, parental psychopathology, and stress for first-onset depression during adolescence. J Affect Disord. (2019) 253:232–9. doi: 10.1016/j.jad.2019.04.084

23. Swartz JR, Hariri AR, Williamson DE. An epigenetic mechanism links socioeconomic status to changes in depression-related brain function in high-risk adolescents. Mol Psychiatry. (2017) 22:209–14. doi: 10.1038/mp.2016.82

24. Chen D, Meng L, Pei F, Zheng Y, Leng J. A review of DNA methylation in depression. J Clin Neurosci. (2017) 43:39–46. doi: 10.1016/j.jocn.2017.05.022

25. Klengel T, Binder EB. Epigenetics of stress-related psychiatric disorders and gene × environment interactions. Neuron. (2015) 86:1343–57. doi: 10.1016/j.neuron.2015.05.036

26. Cattaneo A, Cattane N, Begni V, Pariante CM, Riva MA. The human BDNF gene: peripheral gene expression and protein levels as biomarkers for psychiatric disorders. Transl Psychiatry. (2016) 6:e958. doi: 10.1038/tp.2016.214

27. Tadić A, Müller-Engling L, Schlicht KF, Kotsiari A, Dreimüller N, Kleimann A, et al. Methylation of the promoter of brain-derived neurotrophic factor exon IV and antidepressant response in major depression. Mol Psychiatry. (2014) 19:281–3. doi: 10.1038/mp.2013.58

28. Braithwaite EC, Kundakovic M, Ramchandani PG, Murphy SE, Champagne FA. Maternal prenatal depressive symptoms predict infant NR3C1 1F and BDNF IV DNA methylation. Epigenetics. (2015) 10:408–17. doi: 10.1080/15592294.2015.1039221

29. Lieb K, Dreimüller N, Wagner S, Schlicht K, Falter T, Neyazi A, et al. BDNF plasma levels and BDNF Exon IV Promoter Methylation as predictors for antidepressant treatment response. Front Psychiatry. (2018) 9:511. doi: 10.3389/fpsyt.2018.00511

30. Autry AE, Monteggia LM. Brain-derived neurotrophic factor and neuropsychiatric disorders. Pharmacol Rev. (2012) 64:238–58. doi: 10.1124/pr.111.005108

31. Zheleznyakova GY, Cao H, Schiöth HB. BDNF DNA methylation changes as a biomarker of psychiatric disorders: literature review and open access database analysis. Behav Brain Funct. (2016) 12:17. doi: 10.1186/s12993-016-0101-4

32. Boulle F, van den Hove DL, Jakob SB, Rutten BP, Hamon M, van Os J, et al. Epigenetic regulation of the BDNF gene: implications for psychiatric disorders. Mol Psychiatry. (2012) 17:584–96. doi: 10.1038/mp.2011.107

33. Brown A, Fiori LM, Turecki G. Bridging basic and clinical research in early life adversity, DNA methylation, and major depressive disorder. Front Genet. (2019) 10:229. doi: 10.3389/fgene.2019.00229

34. Mitchell AJ, Vaze A, Rao S. Clinical diagnosis of depression in primary care: a meta-analysis. Lancet. (2009) 374:609–19. doi: 10.1016/S0140-6736(09)60879-5

35. World Health Organization The ICD-10 Classification of Mental and Behavioural Disorders: Clinical Descriptions and Diagnostic Guidelines. World Health Organization (1992). Available online at: https://apps.who.int/iris/handle/10665/37958

36. Ferrando BJ, Gibert M, Soto M, Soto O. M.I.N.I. Mini International Neuropsychiatric Interview. Versión en español 5.0.0.DSM-IV (2000). Available online at: https://www.academia.cat/files/425-7297-DOCUMENT/MinientrevistaNeuropsiquatribaInternacional.pdf (accessed: April 30, 2020).

PubMed Abstract

37. Londoño NH, Calvete E, Ferrer A, Chaves L, Castrillón D, Schnitter M, et al. Young schema questionnaire – short form, validación en Colombia. Univ Psychol. (2012) 11:147–64. doi: 10.11144/Javeriana.upsy11-1.ysqv

38. Young JE. Cognitive therapy for personality disorders: a schema-focused approach, 3rd ed. In: Cogn Ther Personal Disord A schema-focused Approach, 3rd Edn . (1999). p. 83.

39. Lewin J, Schmitt AO, Adorján P, Hildmann T, Piepenbrock C. Quantitative DNA methylation analysis based on four-dye trace data from direct sequencing of PCR amplificates. Bioinformatics. (2004) 20:3005–12. doi: 10.1093/bioinformatics/bth346

40. Pereira R, Phillips C, Pinto N, Santos C, dos Santos SEB, Amorim A, et al. Straightforward inference of ancestry and admixture proportions through ancestry-informative insertion deletion multiplexing. PLoS ONE. (2012) 7:e29684. doi: 10.1371/journal.pone.0029684

41. Asif M, Rahman M, Mirza JI, Zafar Y. High resolution metaphor agarose gel electrophoresis for genotyping with microsatellite markers. Pak J Agric Sci. (2008) 45:75–9.

42. Applied Biosystems. Thermo Fisher Scientific. GeneMapper ID-X. v 1.2 (2009). Available online at: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/cms_072557.pdf (accessed: April 30, 2020)

43. Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. (2000) 155:945–59. doi: 10.1093/genetics/155.2.945

44. Rstudio Team. RStudio: Integrated Development for R. RStudio, Inc. Boston MA. RStudio (2016).

45. Yan B, Xu X, Liu M, Zheng K, Liu J, Li J, et al. Quantitative identification of major depression based on resting-state dynamic functional connectivity: a machine learning approach. Front Neurosci. (2020) 14:191. doi: 10.3389/fnins.2020.00191

46. Akechi T, Mantani A, Kurata K, Hirota S, Shimodera S, Yamada M, et al. Predicting relapse in major depression after successful initial pharmacological treatment. J Affect Disord. (2019) 250:108–13. doi: 10.1016/j.jad.2019.03.004

47. Gałecki P, Talarowska M. Neurodevelopmental theory of depression. Prog Neuropsychopharmacol Biol Psychiatry. (2018) 80:267–72. doi: 10.1016/j.pnpbp.2017.05.023

48. Hammen C. Stress generation in depression: Reflections on origins, research, and future directions. J Clin Psychol. (2006) 62:1065–82. doi: 10.1002/jclp.20293

49. Bradley RG, Binder EB, Epstein MP, Tang Y, Nair HP, Liu W, et al. Influence of child abuse on adult depression: moderation by the corticotropin-releasing hormone receptor gene. Arch Gen Psychiatry. (2008) 65:190–200. doi: 10.1001/archgenpsychiatry.2007.26

50. Calvete E. Emotional abuse as a predictor of early maladaptive schemas in adolescents: contributions to the development of depressive and social anxiety symptoms. Child Abus Negl. (2014) 38:735–46. doi: 10.1016/j.chiabu.2013.10.014

51. Yigit I, Kiliç H, Guzey Yigit M, Çelik C. Emotional and physical maltreatment, early maladaptive schemas, and internalizing disorders in adolescents: a multi-group path model of clinical and non-clinical samples. Curr Psychol . (2018) 40:1356–66. doi: 10.1007/s12144-018-0068-4

CrossRef Full Text

52. Davoodi E, Wen A, Dobson KS, Noorbala AA, Mohammadi A, Farahmand Z. Early maladaptive schemas in depression and somatization disorder. J Affect Disord. (2018) 235:82–9. doi: 10.1016/j.jad.2018.04.017

53. Harris AE, Curtin L. Parental perceptions, early maladaptive schemas, and depressive symptoms in young adults. Cognit Ther Res. (2002) 26:405–16. doi: 10.1023/A:1016085112981

54. Calvete E, Orue I, Hankin BL. A longitudinal test of the vulnerability-stress model with early maladaptive schemas for depressive and social anxiety symptoms in adolescents. J Psychopathol Behav Assess. (2015) 37:85–99. doi: 10.1007/s10862-014-9438-x

55. Roelofs J, Lee C, Ruijten T, Lobbestael J. The mediating role of early maladaptive schemas in the relation between quality of attachment relationships and symptoms of depression in adolescents. Behav Cogn Psychother. (2011) 39:471–9. doi: 10.1017/S1352465811000117

56. Wegener I, Alfter S, Geiser F, Liedtke R, Conrad R. Schema change without schema therapy: The role of early maladaptive schemata for a successful treatment of major depression. Psychiatry. (2013) 76:1–17. doi: 10.1521/psyc.2013.76.1.1

57. Flink N, Lehto SM, Koivumaa-Honkanen H, Viinamäki H, Ruusunen A, Valkonen-Korhonen M, et al. Early maladaptive schemas and suicidal ideation in depressed patients. Eur J Psychiatry. (2017) 31:87–92. doi: 10.1016/j.ejpsy.2017.07.001

58. Halvorsen M, Wang CE, Eisemann M, Waterloo K. Dysfunctional attitudes and early maladaptive schemas as predictors of depression: a 9-year follow-up study. Cognit Ther Res. (2010) 34:368–79. doi: 10.1007/s10608-009-9259-5

59. Camara M, Calvete E. P-122 - Cognitive schemas predicting anxiety and depressive symptoms: the role of dysfunctional coping strategies. Eur Psychiatry. (2012) 27:1. doi: 10.1016/S0924-9338(12)74289-X

60. Balsamo M, Carlucci L, Sergi MR, Murdock KK, Saggino A. The mediating role of early maladaptive schemas in the relation between co-rumination and depression in young adults. PLoS ONE. (2015) 10:e0140177. doi: 10.1371/journal.pone.0140177

61. Park C, Rosenblat JD, Brietzke E, Pan Z, Lee Y, Cao B, et al. Stress, epigenetics and depression: a systematic review. Neurosci Biobehav Rev. (2019) 102:139–52. doi: 10.1016/j.neubiorev.2019.04.010

62. He H, Tian J, Deng Y, Xiong X, Xu Y, Liao Y, et al. Association of brain-derived neurotrophic factor levels and depressive symptoms in young adults with acne vulgaris. BMC Psychiatry. (2019) 19:193. doi: 10.1186/s12888-019-2182-8

63. Kundakovic M, Jaric I. The epigenetic link between prenatal adverse environments and neurodevelopmental disorders. Genes. (2017) 8:104. doi: 10.3390/genes8030104

64. Keller S, Sacchetti S, Lembo F, Monticelli A, Cocozza S, Fusco A, et al. Increased BDNF promoter methylation in the Wernicke area of suicide subjects. Arch Gen Psychiatry. (2010) 67:258–67. doi: 10.1001/archgenpsychiatry.2010.9

65. Kundakovic M, Gudsnuk K, Herbstman JB, Tang D, Perera FP, Champagne FA. DNA methylation of BDNF as a biomarker of early-life adversity. Proc Natl Acad Sci. (2015) 112:6807–13. doi: 10.1073/pnas.1408355111

66. Januar V, Ancelin ML, Ritchie K, Saffery R, Ryan J. BDNF promoter methylation and genetic variation in late-life depression. Transl Psychiatry. (2015) 5:e619. doi: 10.1038/tp.2015.114

67. Zheng F, Zhou X, Moon C, Wang H. Regulation of brain-derived neurotrophic factor expression in neurons. Int J Physiol Pathophysiol Pharmacol . (2012) 4:188−200.

PubMed Abstract | Google Scholar

68. Maisonpierre PC, Le Beau MM, Espinosa R, Ip NY, Belluscio L, de la Monte SM, et al. Human and rat brain-derived neurotrophic factor and neurotrophin-3: gene structures, distributions, and chromosomal localizations. Genomics. (1991) 10:558–68. doi: 10.1016/0888-7543(91)90436-I

69. Knorr U, Søndergaard MHG, Koefoed P, Jørgensen A, Faurholt-Jepsen M, Vinberg M, et al. Increased blood BDNF in healthy individuals with a family history of depression. Psychiatry Res. (2017) 256:176–9. doi: 10.1016/j.psychres.2017.06.057

70. Ikegame T, Bundo M, Murata Y, Kasai K, Kato T, Iwamoto K. DNA methylation of the BDNF gene and its relevance to psychiatric disorders. J Hum Genet. (2013) 58:434–8. doi: 10.1038/jhg.2013.65

71. Messeguer X, Escudero R, Farré D, Núñez O, Martínez J, Albà MM. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics. (2002) 18:333–4. doi: 10.1093/bioinformatics/18.2.333

72. Pace TW, Miller AH. Cytokines and glucocorticoid receptor signaling. Relevance to major depression. Ann N Y Acad Sci . (2009) 1179:86–105. doi: 10.1111/j.1749-6632.2009.04984.x

73. Pariante CM, Miller AH. Glucocorticoid receptors in major depression: relevance to pathophysiology and treatment. Biol Psychiatry. (2001) 49:391–404. doi: 10.1016/S0006-3223(00)01088-X

74. Yamashita A, Sakai Y, Yamada T, Yahata N, Kunimatsu A, Okada N, et al. Generalizable brain network markers of major depressive disorder across multiple imaging sites. PLoS Biol. (2020) 18:e3000966. doi: 10.1371/journal.pbio.3000966

75. Hundt NE, Nelson-Gray RO, Kimbrel NA, Mitchell JT, Kwapil TR. The interaction of reinforcement sensitivity and life events in the prediction of anhedonic depression and mixed anxiety-depression symptoms. Pers Individ Dif. (2007) 43:1001–12. doi: 10.1016/j.paid.2007.02.021

76. Toyoshima K, Inoue T, Kameyama R, Masuya J, Fujimura Y, Higashi S, et al. BIS/BAS as moderators in the relationship between stressful life events and depressive symptoms in adult community volunteers. J Affect Disord Rep. (2021) 3:100050. doi: 10.1016/j.jadr.2020.100050

Keywords: major depressive disorder, BDNF, maladaptive cognitive schemas, methylation, epigenetics, family history of depression

Citation: Velásquez MM, Gómez-Maquet Y, Ferro E, Cárdenas W, González-Nieves S and Lattig MC (2021) Multidimensional Analysis of Major Depression: Association Between BDNF Methylation, Psychosocial and Cognitive Domains. Front. Psychiatry 12:768680. doi: 10.3389/fpsyt.2021.768680

Received: 01 September 2021; Accepted: 22 November 2021; Published: 14 December 2021.

Reviewed by:

Copyright © 2021 Velásquez, Gómez-Maquet, Ferro, Cárdenas, González-Nieves and Lattig. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) . The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: María Marcela Velásquez, mm.velasquez@uniandes.edu.co

Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

• Essay Database
• world trade center
• Greek Food and Culture
• The Future Portrayed I…
• Intercultural Communications
• In Heart of Darkness, …
• Things Fall Apart by C…
• In J.M. Coetzee's Wait…
• The Criminals Of Profe…
• Socialization of Children
• The Poet of Nature, Wi…
• Leonhard Euler
• Articles of Confederat…
• About all Sharks
• Vietnam Poetry

Major Depressive Disorder

What is paper-research.

• Custom Writing Service
• Terms of Service
• Privacy Policy
• Biographies

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Review Article
• Open access
• Published: 09 February 2024

Major depressive disorder: hypothesis, mechanism, prevention and treatment

• Lulu Cui 1 , 2 , 3 ,
• Shu Li 1 , 2 , 3 ,
• Siman Wang 1 , 2 , 3 ,
• Xiafang Wu 1 , 2 , 3 ,
• Yingyu Liu 1 , 2 , 3 ,
• Weiyang Yu 1 , 2 , 3 ,
• Yijun Wang 1 , 2 , 3 ,
• Yong Tang   ORCID: orcid.org/0000-0002-2543-066X 4 ,
• Maosheng Xia   ORCID: orcid.org/0000-0003-4829-0812 5 &
• Baoman Li   ORCID: orcid.org/0000-0002-3959-9570 1 , 2 , 3  

Signal Transduction and Targeted Therapy volume  9 , Article number:  30 ( 2024 ) Cite this article

30k Accesses

6 Citations

432 Altmetric

Metrics details

• Cellular neuroscience
• Diseases of the nervous system

Worldwide, the incidence of major depressive disorder (MDD) is increasing annually, resulting in greater economic and social burdens. Moreover, the pathological mechanisms of MDD and the mechanisms underlying the effects of pharmacological treatments for MDD are complex and unclear, and additional diagnostic and therapeutic strategies for MDD still are needed. The currently widely accepted theories of MDD pathogenesis include the neurotransmitter and receptor hypothesis, hypothalamic-pituitary-adrenal (HPA) axis hypothesis, cytokine hypothesis, neuroplasticity hypothesis and systemic influence hypothesis, but these hypothesis cannot completely explain the pathological mechanism of MDD. Even it is still hard to adopt only one hypothesis to completely reveal the pathogenesis of MDD, thus in recent years, great progress has been made in elucidating the roles of multiple organ interactions in the pathogenesis MDD and identifying novel therapeutic approaches and multitarget modulatory strategies, further revealing the disease features of MDD. Furthermore, some newly discovered potential pharmacological targets and newly studied antidepressants have attracted widespread attention, some reagents have even been approved for clinical treatment and some novel therapeutic methods such as phototherapy and acupuncture have been discovered to have effective improvement for the depressive symptoms. In this work, we comprehensively summarize the latest research on the pathogenesis and diagnosis of MDD, preventive approaches and therapeutic medicines, as well as the related clinical trials.

Similar content being viewed by others

Prospective biomarkers of major depressive disorder: a systematic review and meta-analysis

Major depressive disorder

Brain connectivity in major depressive disorder: a precision component of treatment modalities?

Introduction.

Major depressive disorder (MDD), a main cause of disability worldwide, is characterized by physical changes such as tiredness, weight loss, and appetite loss. Anhedonia is a classic feature of MDD, and MDD is also accompanied by a lack of drive, sleep issues, cognitive challenges, and emotional symptoms such as guilt. 1 The prevalence of depression is increasing yearly. About 300 million people in the world are affected by MDD, which has become one of the main causes of disability. 2 In 2018, MDD ranked third in terms of disease burden according to the WHO, and it is predicted to rank first by 2030. 3 Pregnant women, elderly people, children, and others have a higher incidence rate of MDD, which may be related to genetic, psychological, and social factors. 4 Depression can be accompanied by recurrent seizures, which may occur even during remission or persist for longer than the disease itself. 5 Pharmacological therapies for MDD can effectively control symptoms; thus, patients may experience recurrence within a short time after discontinuing medication. 6 During recurrence, the patient experiences symptoms of low mood, loss of interest in life, fatigue, delayed thinking, and repeated fluctuations in mental state. 7

There is a certain correlation between the occurrence of MDD and social development. 8 A survey reported that with the development of the economy and increased life pressure, MDD has begun to emerge at a younger age, and the incidence of MDD in women is approximately twice that in men. 9 Specifically, women are more likely to develop depressive symptoms when they encounter social emergencies or are under significant stress. 8 Additionally, autumn and winter have been reported to be associated with a high incidence of MDD, namely, seasonal depression. 10

The clinical symptoms of MDD include a depressed mood, loss of interest, changes in weight or appetite, and increased likelihood of committing suicide. 11 These symptoms are also listed as the criteria for MDD in the Diagnostic and Statistical Manual of Mental Disorders (DSM-5). 12 In addition to the criteria listed in the DSM-5, the criteria reported in the International Classification of Diseases (ICD-10) are also used to guide clinical diagnosis. 13 However, due to the lack of characteristic symptoms and objective diagnostic evidence for MDD, identification and early prevention are difficult in the clinic. 14

Due to the complexity of the pathological mechanism of MDD, accurate diagnostic approaches and pharmacological therapeutic strategies are relatively limited. Several hypothesis were developed to explain MDD pathogenesis pathogenic including (i) the hypothalamic‒pituitary‒adrenal (HPA) axis dysfunction hypothesis, (ii) the monoamine hypothesis, (iii) the inflammatory hypothesis, (iv) the genetic and epigenetic anomaly hypothesis, (v) the structural and functional brain remodeling hypothesis, and (vi) the social psychological hypothesis 3 , 15 , 16 (Fig. 1 ). However, none of these hypotheses alone can fully explain the pathological basis of MDD, while many mechanisms proposed by these hypotheses interact with each other. In recent years, great progress has been made in identifying novel pharmacological therapies, diagnostic criteria, and nonpharmacological preventive measures for MDD, initiating related clinical trials. Specifically, increasing evidence suggests that astrocytic dysfunction plays a substantial role in MDD. 17 Pharmacological ablation of astrocytes in the medial prefrontal cortex (mPFC) causes depressive-like symptoms in experimental animals, 18 and postmortem studies of patients with MDD have shown reduced densities of glial cells in the prefrontal cortex (PFC), hippocampus and amygdala. 19 In addition, glial fibrillary acidic protein (GFAP), one of the markers of astrocytes, is expressed at various levels, 20 and the levels of connexins, 21 glutamine synthase (GS), glutamate transporter-1 (GLT-1), 21 , 22 and aquaporin-4 (AQP4) 23 are reduced in patients with MDD.

An outline map of the hypotheses to explain MDD pathogenesis. (I) HPA axis dysfunction hypothesis: high levels of glucocorticoids (GCs) play a core role in the pathogenesis of MDD, and thyroid hormone (TH) and estrogen are also involved in functions of the HPA axis; (II) the monoamine hypothesis: the functional deficiency of serotonin (5-HT), dopamine (DA) and norepinephrine (NE) are the main pathogenesis of MDD; (III) the inflammatory hypothesis: the neuro-inflammation induced by reactive oxygen species (ROS), inflammatory cytokines and inflammasomes activation is suggested to promote the occurrence of MDD; (IV) the genetic and epigenetic anomaly hypothesis: some genes are susceptible in the patients with MDD, including presynaptic vesicle trafficking (PCLO), D2 subtype of the dopamine receptor (DRD2), glutamate ionotropic receptor kainate type subunit 5 (GRIK5), metabotropic glutamate receptor 5 (GRM5), calcium voltage-gated channel subunit alpha1 E (CACNA1E), calcium voltage-gated channel auxiliary subunit alpha2 delta1(CACNA2D1), DNA methyltransferases (DNMTs), transcription levels of somatostatin (SST), fatty acid desaturase (FADS); (V) the structural and functional brain remodeling hypothesis: the postmortem results of patients with MDD are mostly associated with the reduced densities of glial cells in the prefrontal cortex (PFC), hippocampus, and amygdala; (VI) the social psychological hypothesis: the traumatic or stressful life events are the high risks of the occurrence of MDD. Adobe Illustrator was used to generate this figure

In this review, we summarize the latest research on the etiology, pathogenesis, diagnosis, prevention, mechanism, and pharmacological and nonpharmacological treatment of MDD as well as related clinical experiments.

Potential etiologies and pathogenic hypotheses

The common pathogenic factors.

Although the etiology of MDD is still unclear, it is widely accepted that MDD is associated with multiple pathogenic factor. In addition to well-known mental factors, MDD is also related to genetic factors, social stress, and even other common chronic diseases. Therefore, the etiology of MDD cannot be described from the perspective of a single factor.

Genetic factors

Although the etiology of MDD is still unclear, numerous studies have been performed and various models have been employed to explore the genetic factors, environmental factors and gene-environment interactions related to the disease. 24 Recent family, twin, and adoption studies suggests that genetic factors play a crucial role in the occurrence of MDD. 25 As a genetically diverse illness, MDD has a heritability of 30–50%. 26 Over 100 gene loci, including those associated with presynaptic vesicle trafficking (PCLO), dopaminergic neurotransmission (a primary target of antipsychotics), glutamate ionotropic receptor kainate type subunit 5 (GRIK5), and metabotropic glutamate receptor 5 (GRM5), and neuronal calcium signaling such as calcium voltage-gated channel subunit alpha1 E (CACNA1E) and calcium voltage-gated channel auxiliary subunit alpha2 delta1 (CACNA2D1), are found to be associated with an increased risk of MDD by genome-wide association studies. 19 , 27 , 28 In addition, rare copy number variants are also identified to be related to MDD risk, there may be three copy number variants (CNV) loci associated with Prader-Willis syndrome: 1q21.1 duplication, 15q11-13, and 16p11.2. However, no single genetic variation has been found to increase the risk of MDD thus far. 26 Genome Wide Association Studies (GWAS) identified 178 genetic risk loci and proposed over 200 candidate gene, using of biobank data, novel imputation methods, combined with clinical cases improved the ability to identify MDD specific pathways. 29 In the study of human MDD transcriptome, there are defects in the transcription levels of somatostatin (SST) in the subgenus anterior cingulate cortex and amygdala of MDD patients, 30 , 31 and SST levels are directly involved in the cellular processes that affect the synaptic output of intermediate neuronal circuits. 32 Recent studies revealed that gender specific genomic differences in MDD patients, the downregulation of the MDD-related gene Dusp6 in females leads to an increased susceptibility to stress, but this expression is not present in male mice. 33 In addition, studies of drug gene interactions, transcriptional genes associated with the risk of MDD are also reported, such as D2 subtype of the dopamine receptor (DRD2) and fatty acid desaturase (FADS), 34 which may serve as promising new targets for therapeutic intervention points. Thus, genetic variants are expected to have only minor effects on the overall risk of disease, and various hereditary factors combined with environmental factors such as stress are likely more essential for the development of MDD. 35

Stress factors

In addition to heritable factors, environmental influences such as stress also significantly contribute to the development of MDD, both independently and in conjunction with genetic factors. 26 Numerous studies have suggested that adverse life events can lead to the development of MDD. 18 A major depressive episode always follows a traumatic or stressful life event. In particular, severe events such as job loss, extramarital affairs and divorce are known to provoke the onset of the disease. 36 The exact pathological mechanism by which social stress results in the development of MDD is still not known, mainly due to the difficulty of separating social factors from genetic factors in patients and the impracticality of exposing disease model animals to relevant environmental factors. It has been proved that the changes in the structure and function of neurons may occur under the chronic stress and lead to the occurrence of MDD. 37 , 38 In some MDD patients, stress leads to long-term elevated glucocorticoids, resulting in synaptic structural changes and remodeling, and the stress-induced hyperactivity of the HPA axis leads to negative feedback imbalance of the HPA axis, which is also related to depression. 39 Studies on damage to microglia and astrocytes suggest the significance of glial cells in the development of environmental factor-induced depression-like behaviors in mice. 40 In addition, our previous studies proved that chronic environmental stress-induced depressive-like behaviors in mice can be dependent on purinergic ligand-gated ion channel 7 receptor (P2X 7 R) activation in astrocytes. 41

Comorbidity factors

The existence of various physiological and psychological comorbidities in patients with depression reveals a clear link between physical and mental health, which has given us a better understanding of MDD. The presence of MDD is a risk factor for a variety of complications, including neurodegenerative diseases (such as dementia, Alzheimer’s disease, and Parkinson’s disease), cardiovascular diseases (such as ischemic coronary artery disease and myocardial infarction), metabolic and endocrine diseases (such as obesity in females and diabetes in males), and some autoimmune diseases. 42 , 43 The relationship between the onset of MDD and several diseases is complex and potentially bidirectional in nature. 44 The impact of depression on society and the economy is increased by the existence of comorbidities. 45 Specifically, in 2018, comorbid disorders rather than MDD itself were responsible for 63% of all costs related to MDD in the United States. 46 , 47 Furthermore, compared to people without depression, patients with MDD have been demonstrated to have a shorter life expectancy. 48 Additionally, the worsening of comorbidities could be a factor in the premature mortality of MDD patients. 44

Neurotransmitter and receptor hypothesis

The traditional monoamine theory contends that in addition to common pathogenic factors, deficiencies in monoamine neurotransmitters, such as serotonin (5-HT), dopamine (DA) and norepinephrine (NE), are the root cause of clinical depression. 49 Selective serotonin reuptake inhibitors (SSRIs), a class of antidepressants that have been proven to successfully treat clinical depression, were developed in response to this hypothesis, which was derived primarily on the basis of the pharmacological mechanism of drug that were accidentally discovered to act as antidepressants. It is also crucial to note that astrocytes express NE transporter (NETT) and 5-HT transporter (SERT), which are the targets of some traditional antidepressants. 50 A previous study suggested that the function of astrocytes can be directly regulated by SSRIs. 51 Monoamine oxidase (MAO) activates the metabolism of adrenaline and triggers calcium signaling in astrocytes, 52 which suggests that antidepressants may directly affect astrocytes by preventing them from reabsorbing monoamines.

Serotonin (5-HT)

An essential neuromodulatory transmitter with specific neuroplastic properties is serotonin. Numerous investigations have demonstrated that 5-HT is intimately related to the pathophysiological process of major depression. The 5-HT hypothesis primarily asserts that a decrease in the 5-HT level is a risk factor for depression. 53 In addition, low levels of 5-HT and L-tryptophan, which is a precursor of 5-HT, 54 in blood platelets are also found in depressed people. Additionally, long-term treatment with fluoxetine, a typical SSRIs, reverses the stress-induced reduction in the quantity of astrocytic cells in the hippocampus in a tree shrew model of depression. 55

5-HT receptors, which are mostly found on the bodies and dendrites of neurons, play a role in the pathogenesis of MDD. 56 To date, 5-HT receptor subfamilies comprising 14 different receptor subunits expressed in various brain regions, namely, 5-HT 1A , 5-HT 1B , 5-HT 1D , 5-HT 1E , 5-HT 1F , 5-HT 2A , 5-HT 2B , 5-HT 2C , 5-HT 3 , 5-HT 4 , 5-HT 5A , 5-HT 5B , 5-HT 6 and 5-HT 7 , have been reported. Among these 5-HT receptor subtypes, the 5-HT 1 , 5-HT 2 , 5-HT 6 , and 5-HT 7 subtypes are expressed on brain and spinal astrocytes in humans and rodents. Numerous 5-HT receptors expressed on astrocytes are G-coupled proteins that are associated with changes in the concentration of free cytosolic calcium ([Ca 2+ ] i ). These changes may trigger the release of a variety of astrocyte-derived signaling modulators, which may control neuronal activity. 57 In astrocytes, 5-HT has a strong effect on the 5-HT 2B receptor. 58 5-HT receptors have been extensively studied to determine the pharmacological mechanism of antidepressants, and many novel pharmaceutical preparations are being investigated. For example, some novel antidepressants function as agonists of the 5-HT 1A , 5-HT 2B , or 5-HT 4 receptor or antagonists of the 5-HT 1B , 5-HT 2A , 5-HT 2C , 5-HT 3 , 5-HT 6 , or 5-HT 7 receptor. 59

Administration of fluoxetine in different concentrations to astrocytes expressing the 5-HT 2B receptor may activate distinct signaling pathways to control gene expression. Fluoxetine reduces the mRNA expression of c-Fos through the PI3K/AKT signaling pathway after acute application at concentrations below 1 μM, while the treatments with the higher doses (above 5 μM), it increases the gene expression of c-Fos via the MAPK/ERK signaling pathway in astrocytes. 60 Then, in the nucleus, the altered transcription factor c-Fos can further biphasic change the expression of caveoline under the chronic treatments, thus the alteration levels of caveoline on cellular membrane can finally affect the downstream activation of PTEN/PI3K/AKT/GSK3β 60 . The GSK3β polymorphisms are associated with the high risk of MDD in Chinese Han Population. 61 In our recent reports, the activation of GSK3β is also increased in the sorted astrocytes from the MDD-related stress-treated mice model and MDD clinic patients’ plasma. 62 In addition, after fluoxetine-mediated stimulation of the 5-HT 2B receptor in astrocytes, epidermal growth factor receptor (EGFR) is transactivated and subsequently activates the MAPK/ERK and PI3K/AKT signaling cascades, which control the expression of mRNA or proteins that may be linked to mood disorders, such as SERT. Ca 2+ -dependent phospholipase A2 (cPLA 2 ), adenosine deaminase acting on RNA 2 (ADAR2), and kainate receptor subtype 2 (GluK2) are all involved in kainate receptor signaling. 63 , 64 These discoveries promise astrocytic 5-HT 2B receptors can be the potential pharmacological target of SSRIs (Fig. 2 ).

Schematic illustration of the pharmacological mechanism of fluoxetine in astrocytes. Acute treatment with fluoxetine at low concentrations (green arrows) stimulates Src, which phosphorylates EGF receptors by activating 5-HT 2B receptors (5-HT 2B R) and activates the PI3K/AKT signaling pathway. AKT phosphorylation induced by fluoxetine at low concentrations inhibits the expression of cFos and subsequently decreases the expression of caveolin-1 expression (chronic effects), which in turn decreases the membrane content of PTEN, induces phosphorylation and stimulation of PI3K and increases the phosphorylation of GSK3β, thus suppressing its activity. At higher concentrations, fluoxetine (red arrows) stimulates metalloproteinases (MMP) by activating 5-HT 2B R and induces the release of growth factors, which stimulates EGF receptors and activates the mitogen-activated protein kinases (MAPK)/ERK 1/2 signaling pathway. ERK 1/2 phosphorylation induced by fluoxetine at high concentrations stimulates the expression of cFos and subsequently increases the expression of caveolin-1 (chronic effects), which inhibits PTEN/PI3K/AKT/GSK3β, 60 ultimately leading to MDD like behavior. At high concentration, fluoxetine can also stimulate the activation of cPLA 2a by the transactivation of EGFR/MAPK/ERK 1/2 pathway, and the activated ERK 1/2 can also increases the expression of cPLA 2a at chronic treatments. 61 In addition, the increased expression of cFos induced by fluoxetine can further increases the RNA editing of GluK2 by increasing the expression of ADAR2 at the chronic treatments, the function of the edited GluK2 by fluoxetine is down-regulated, which causes the acute glutamated induced Ca 2+ -dependent ERK phosphorylation is suppressed. 63 Adobe Illustrator was used to generate this figure

Norepinephrine (NE)

NE released by the locus coeruleus (LC) can participate in regulating various neural functions, such as smell, movement, and sensation. 65 It is significant to note that after being released, noradrenaline (NA) is not restricted to the area around the synaptic cleft and can reach nearby glial cells. 66 Atomoxetine is a norepinephrine reuptake inhibitor (NRI) clinically used for the treatment of MDD. After systemic inflammatory attack with bacterial lipopolysaccharide (LPS), atomoxetine can decrease neuroinflammation in the rat cerebral cortex. 67

The bioavailability of 5-HT and NE are increased by antidepressants called serotonin/norepinephrine reuptake inhibitors (SNRIs), which belong to antidepressants. Currently, new SNRIs, including duloxetine (DXT), 68 desvenlafaxine (DVS), 69 and venlafaxine, 70 are widely used in MDD patients resistant to other treatments. Chronic treatment with DXT increases the expression of connexin 43 (Cx43), a crucial component of astrocyte gap junctions, in the rat PFC, preventing chronic unpredictable stress-induced dysfunction of astrocyte gap junctions and reversing the depressive-like behaviors caused by gap junction inhibition. 71 A novel therapeutic target for MDD is transforming growth factor β1 (TGF-β1), the expression of which is controlled by antidepressants. Venlafaxine has also been found to exert neuroprotection by boosting the production of type 2 fibroblast growth factor (FGF-2) and transforming growth factor 1 TGF-β1 in astrocytes following stroke. 72 However, the expression of protein markers of astrocytes and neurons is unaffected by DVS, and the chronic unpredictable mild stress (CUMS)-induced reduction in the levels of myelin- and oligodendrocyte-related proteins can be prevented by DVS. 69 DVS may reduce oligodendrocyte dysfunction in the CUMS mouse model by altering cholesterol production and reducing depression-like phenotypes. 69

Dopamine (DA)

There is increasing evidence that people with depression have reduced dopamine neurotransmission. 73 Astrocytes in the lateral habeula are involved in regulating depressive-like behavior, 74 whereas the reward circuit is mediated by the striatum. 75 The dorsolateral part of the striatum is linked to the drug-seeking behavior and drug addiction associated with psychiatric disorders. As the major input to the basal ganglia, the striatum and related nuclei are linked to psychiatric morbidity, while the chronic stress reduces dopamine levels in areas such as the striatum and hippocampus. 76 Due to processes involving dopamine D2 receptor signaling, 77 the glutamine level increases in the presence of dopaminergic lesions and decreases in the presence of a high DA level. 78 DA signaling is considered to play a key role in astrocyte-neuron crosstalk in the striatum. 79 Sulpiride is an antidepressant that blocks the ability of the GLT-1 inhibitor TFB-TBOA to induce synaptic depression 80 and partly attenuates the impact of fluorocitrate (a metabolic uncoupler that blocks aconitase in the tricarboxylic acid (TCA) cycle) on synaptic output. According to these results, astrocyte dysfunction results in an increase in DA levels, which decreases neuronal activity resulting from the binding of DA to dopamine D2 receptors, 80 which generates neuronal depolarization, reducing DA selectivity at dopamine D1-like receptors and promoting DA inhibition through dopamine D2 receptors, which may contribute to increasing extracellular glutamate levels. 81 An increase in DA signaling brought on by compromised astrocyte activity may induce a long-lasting change in striatal neurotransmission 80 since DA signaling is crucial for both structural and synaptic plasticity. 82

Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) 83 and can be released by neurons through exocytosis, which in turn activates extracellular N-methyl-D-aspartate receptors (eNMDARs) in neurons, leading to synaptic loss. 84 Exosynaptic glutamate also contributes to metabolism in neurons and astrocytes. When exosynaptic glutamate is taken up by astrocytes, it can become a substrate for glutamine synthesis or be metabolized by astrocytes and neurons. 85 In addition, extracellular glutamate can also promote glucose uptake by astrocytes and inhibit glucose uptake by neurons. Therefore, glutamate is an important signal that mediates the interaction between central neurons and astrocytes, and its normal release and transport are the result of the functional cooperation between neurons and astrocytes. Glutamate homeostasis and neurotransmission play a major role in the onset of depression and anxiety. Studies have shown that glutamate levels in frontal cortex samples from autopsied patients with severe depression are increased, and antidepressants can restore normal glutamate levels. 86 It has been observed in animal models that sustained glucocorticoid stimulation can increase the excitability of glutamatergic neurons and simultaneously decrease the number and plasticity of astrocytes, in addition to decreasing neuronal dendrite connectivity in the hippocampus and frontal cortex, leading to depression. 87

It is well-documented that astrocytes have a wide range of modulatory functions that may either increase or decrease the release of many different neurotransmitters. Specifically, astrocytes are essential regulators of glutamatergic neurotransmission, and reuptake of glutamate by astrocytes regulates excitatory synaptic activity. 85 When a large amount of glutamate is released from neuronal vesicles, glutamate clearance is mainly achieved by glutamate transporters (EAATs) on the membrane of astrocytes, which transport excess glutamate into astrocytes, where it is converted to glutamylamine through the action of glutamine synthase, reducing damage to neurons. 88 , 89 In the classic glutamate-glutamine cycle, astrocytes and neurons convert glutamate to the nonexcitatory amino acid glutamine, which is then released back into the extracellular space and absorbed by neurons. Alterations in astrocytic glutamate clearance are known to occur in schizophrenia and other psychiatric illnesses, and mice with glutamate/aspartate transporter (GLAST) deletion show phenotypic abnormalities such as mental and behavioral deficits. 90 , 91

Adenosine triphosphate (ATP)

Ectonucleotidases that are found in synapses can catabolize extracellular ATP to produce adenosine, and synapses also contain bidirectional nucleoside transporters that can release adenosine. 92 Adenosine primarily stimulates inhibitory A1 and facilitatory adenosine receptors (A 2A R) to play function. 93 Notably, depressive behavior is linked to purinergic signaling. Depressive-like symptoms are exacerbated by activation of P2X 7 R in glial cells. 94 Polimorphisms at P2X 7 R increase vulnerability to mood disorders whereas P2X 2 R-mediated neuronal activity is decreased in mice exposed to chronic stress due to insufficient ATP release from astrocytes. 95 According to our earlier studies, chronic sleep deprivation (SD) can cause depressive-like behaviors by increasing extracellular ATP levels in vivo. 41 Acting through P2X 7 R and FoxO3a cascade ATP inhibits expression of the 5-HT 2B receptor, the decrease in extracellular ATP levels caused by chronic stress and an increase in ATP levels caused by SD are both linked to depressive-like behaviors. 41 In detail, the elevated extracellular ATP induced by SD stress stimulates P2× 7 R and down-regulates the expression of 5-HT 2B R by suppressing the activation of AKT, which inhibits the phosphorylation of FoxO3a and promotes its transportation into the nucleus, the reduced 5-HT 2B R alleviates the inhibition of STAT3 to cPLA 2 , the activated cPLA 2 further increases the release of AA and PGE2, these indicators have high relationship with the depressive-like behaviors, because in P2X 7 R knockout mice, the above changes of these indicators and behavioral performance are all eliminated. 41 This increased activation of cPLA 2 and the elevated levels of AA and PGE2 in astrocytes are supported by our discoveries in MDD patients’ plasma. 62

After building a stress injury model in rats through maternal separation (MS), it is found that MS obviously reduces the total length of apical dendrites, however, the use of A 2A R antagonists could prevent synaptic loss 96 and reverse behavioral, electrophysiological, and morphological damage caused by MS, 97 this is related to the activity reconstruction of the HPA axis. In another study, the abnormally increased A 2A R in the lateral septum(LS) is a key factor in recurrent stress for leading to depressive-like behaviors. This function is mainly achieved by the increased activity of A 2A R-positive neurons and the inhibited activity of ambient neurons, associating with the neural circuits of dorsomedial hypothalamus(DMH) and lateral habenular(LHb). 98

Caffeine is an adenosine receptor antagonist, and epidemiological studies have shown that the intake of caffeine is closely related to the occurrence of suicide 99 and depression. 100 Since A 2A R polymorphisms are associated with emotional problems, adenosine A 2A R overexpression leads to emotional dysfunction, and A 2A R blockade protects against the persistent emotional disturbance brought on by stress. 101 Moreover, animal experiments have demonstrated that A 2A R are upregulated in chronic stress animal models. 102 Additionally, neuronal A1 receptors exhibit hypofunction caused by a decrease in astrocyte-derived adenosine levels; 103 this decrease, as well as depressive-like behavior, can be reversed by certain antidepressants. 104 , 105

HPA axis hypothesis

Stress and MDD are closely related, and stressful life events can often lead to depressive episodes. The activation of the HPA axis by stress can cause cognitive and emotional changes. 106 An increase in HPA activity is one of the most common neurobiological alterations in depressed people. Studies have shown that the main factor contributing to the elevation of hypothalamic-pituitary activity is the increased production of corticotropin-releasing hormone (CRH). In addition, pituitary adrenal corticotropic hormone (ACTH) is released in response to CRH, which in turn triggers the adrenal cortex to release glucocorticoids (GCs).

Glucocorticoids

The HPA axis, a component of the neuroendocrine system, is commonly associated with the stress response. Hyperactivity of the HPA axis is thought to be an important pathophysiological mechanism underlying depression. High HPA activity is among the most typical neurobiological alterations in depressed individuals. The HPA axis is the primary stress response system that produces GCs, which are a class of steroid hormones. There is evidence that GCs, which are released in response to stress, are harmful to neurons in various brain regions. The hypothalamic paraventricular nucleus (PVN) rapidly secretes CRH and arginine vasopressin (AVP) 107 when the HPA axis is activated by stress. The anterior pituitary is stimulated by CRH and AVP to produce ACTH, which in turn increases the release of GCs into the bloodstream. 108

The GC and mineralocorticoid (MC) receptors GR and MR are members of the nuclear receptor (NR) superfamily. Both NRs can be triggered by binding to either MCs (such as aldosterone) or GCs (such as cortisol). However, the affinity of MR for its ligands is 10 times higher than that of GR for its ligands. 109 , 110 GRs are expressesd at higher levels and particularly concentrated in the pituitary and hypothalamus, as well as a variety of regions of the limbic system (including the amygdala, hippocampus, and PFC), which are important for cognitive and psychological functions.

To prevent loss of control over the HPA axis, GCs exert negative feedback on the axis in all regions involved (the limbic system, hypothalamus, and pituitary). Some data suggest that HPA axis imbalance and high levels of GCs play a core role in the pathogenesis of MDD and suggest that GR may serve as an important target for treating depression. 111

Thyroid hormone

Thyroxine (T4) and triiodothyronine (T3) are the two primary Thyroid hormones (THs) that regulate metabolism, protein synthesis, the growth of bones, and nervous system development. Thyrotropin-releasing hormone (TRH), which regulates the synthesis of thyroid-stimulating hormone (TSH) by the anterior pituitary gland, is mostly produced by neurons in the PVN. TSH stimulates the thyroid gland to produce T3 and T4. The levels of serum-free T4 and free T3 are regulated by negative feedback from pituitary TSH release. Tissue deiodinase mostly transforms T4 into the less physiologically active metabolite reverse T3 and the more biologically active metabolite T4. 112

Overactivity of the HPA axis may be caused by damaged astrocytes and aberrant GR function. The HPA and hypothalamic-pituitary-thyroid (HPT) axes are inextricably linked. The most important related finding is that cortisol directly affects TRH secretion (which regulates TSH release), potentially through the response of GCs to TRH mRNA expression in neurons. According to research, hypercortisolemia may result in a reduction in TRH mRNA levels in the mid-caudal PVN. 113 TRH expression in the PVN is lower in nonpsychiatric patients treated with corticosteroids, and the mRNA levels of TRH are lower in the PVN of depressed patients who have recurrent suicidal thoughts. This suggests that the effect of hypothalamic TRH is weaker in these individuals.

THs are required for neuronal growth and function not only in the periphery but also in the CNS, 114 where they promote the formation of microglia, astrocytes, including radial glial cells, and oligodendrocytes. The role of THs in glial cells is becoming clear because of new discoveries in the field of glial cell biology. THs affect the shape and proliferation of astrocytes, as well as the organization and expression of GFAP/vimentin, and boost GS activity. 115 T3 has an effect on glial morphology and hence on glial function in the adult brain; therefore, it also has an effect on neuron-glia interactions. 115 , 116 It has been shown that T3 induces astrocyte proliferation by autocrine production of growth factors such as epidermal growth factor (EGF) and FGF-2. Apart from their proliferation-promoting impact, these growth factors increase and modify the pattern of deposition of the extracellular matrix components laminin and fibronectin, therefore boosting cell adherence and attachment to the substratum. Together with the discovery that animals with hypothyroidism and mice with TH receptor mutations display significant defects in glial development, these findings indicate that astrocytes are TH targets and that TH can protect neurons and astrocytes from glutamate toxicity. 115

The hippocampus is closely related to memory and learning, and estrogen plays an important role in these processes. Estrogen increases the proliferation, migration, and differentiation of neurons in the dentate gyrus to maintain hippocampal function and is also important for controlling the HPA axis. 117

Estrone (E1), estradiol (E2), and estriol (E3) are the three physiological estrogens; among these estrogens, E2 is the most active, and its level quickly decreases throughout menopause. 118 E2 has been demonstrated in numerous studies to alter systems involved in the pathophysiology of depression, including the serotonin and norepinephrine systems, and to considerably alleviate depressive symptoms in animal models. Estrogen therapy can decrease the quantity of 5-HT 1 and β-adrenergic receptors while increasing the quantity of 5-HT 1 receptors. 119 In addition, estradiol may influence the pathogenesis of male MDD patients. 120 In animal models, E2 has been shown to alleviate depressive-like behavior. 121 , 122 Estrogen receptor 1 (ER1) and estrogen receptor 2 (ER2) are transcription factors that are members of the NR family. Activating ER2 with a range of ER2 agonists has been reported to reduce stress-induced HPA activity and anxiety-like behaviors. 123 , 124

Astrocytes are estrogen targets, 125 as both ER1 and ER2 receptors are present on the astrocyte membrane or intracellularly in astrocytes. The transmembrane receptors ER and GPR30 have been shown to facilitate nongenomic and fast estrogen signaling in astrocytes, contributing to the neuroprotective effects of E2. In mature astrocytes differentiated from human induced pluripotent stem cells (iPSC)-derived astrocyte progenitors, ketamine can exert rapid antidepressant effects through the activation of amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) glutamate receptors, and estrogen enhances this effect of ketamine by increasing the gene expression of AMPA receptor subunits. 126

The obese gene (OB) encodes the hormone leptin, which is derived from adipocytes and the stomach and exerts its function through a specific receptor (OB-R). Leptin controls the function of the HPA axis 127 via its receptor in the hypothalamus. The cerebral cortex, hippocampus, hypothalamus, dorsal raphe (DR) nucleus, arcuate nucleus, and solitary tract nucleus are some regions of the brain that can express leptin receptors. Increasing experimental data have recently shown that leptin is linked to the pathological and physiological processes of numerous mental illnesses and plays a vital regulatory role in the CNS. 128 , 129 According to our previous reports, leptin can enhance the pharmacological effects of fluoxetine in astrocytes sorting from GFAP-GFP transgenic mice. 130 Leptin selectively increases the expression of the astrocytic 5-HT 2B receptor by activating the JAK2/STAT3 pathway, and fluoxetine in turn stimulates the 5-HT 2B receptor and increases the secretion of brain-derived neurotrophic factor (BDNF) from astrocytes in vivo, thus ameliorating depressive-like behaviors. 130 All of these findings indicate leptin’s potential to boost protein expression and functionally stimulate SERT.

Cytokine hypothesis

MDD is accompanied by changes in the levels of proinflammatory cytokines and trophic factors, including BDNF, interleukins (IL-1β, IL-6), and tumor necrosis factor alpha (TNF-α). Increasing data suggest that the production of certain cytokines by brain astrocytes plays a significant role in the pathogenesis of MDD.

Oxidative stress

Oxidative stress (OS), which is caused by an imbalance between antioxidants and reactive oxygen species (ROS), can harm proteins, lipids, or DNA. The activity of monoamine oxidase, the enzymes that break down monoamines such as DA, 5-HT and NE, is influenced by ROS and in turn can increase ROS production in mitochondria. The brain is more vulnerable to OS than other organs. In depression, OS plays a crucial role. 131 , 132 The brain is particularly sensitive to OS due to numerous variables, including rapid oxidative energy metabolism (a process through which ROS, which are harmful molecules, are constantly produced), high levels of unsaturated fatty acids (which are vulnerable to lipid peroxidation), and relatively low intrinsic antioxidant capability. 133 Adults with MDD exhibit ROS-mediated reductions in nitric oxide (NO)-dependent dilation. 134

Thioredoxin reductase, heme-oxygenase 1, glutathione, and glutathione peroxidase are only a few of the ROS-detoxifying enzymes that are abundant in astrocytes. 135 Astrocytes are the major producers of glutathione in the brain because they express a system xc-cyttine/glutamate antiporter, which does not exist in neurons; hence, neurons cannot synthesize glutathione. Notably, astrocytes can protect nearby neurons against toxic dosages of NO, H 2 O 2 , and superoxide anion in combination with NO, iron, or 6-hydroxydopamine in coculture systems, 135 indicating that neurons rely on the strong antioxidant capacity of astrocytes for protection against OS. Nuclear factor erythroid 2 (Nrf2), a redox-sensitive transcription factor required for coordinating the cellular antioxidant response, can be activated by astrocytes. In our recent study, lithium salt (Li + ) was found to effectively alleviate ischemia-induced anhedonia in mice by suppressing the production of mitochondrial ROS in glial cells. 136

Recent investigations have indicated that MDD is caused by increased ROS production and promotes inflammation. 137 The brain has weak antioxidative defenses and a high oxygen consumption rate, making it particularly susceptible to OS. Inflammasomes in microglia can be activated by ROS, which causes inflammatory cytokines, including TNF-α, IL-1β, and IFN-γ, to be produced. 138 Neuroendocrine-immune activities can be compromised by inflammation, which can also result in numerous disorders, such as MDD. Proinflammatory cytokines have become pathological indicators of MDD, and using the right antioxidants to combat ROS may be a useful method for treating MDD.

Proinflammatory cytokines

Higher levels of inflammation increase the chance of developing new-onset depression. 138 , 139 Although depression can cause inflammation, its cause is still unclear and may be influenced and regulated by immune cells, inflammatory cytokines, and the nervous system. In addition to contributing to the etiology of depression, activation of proinflammatory signaling pathways occurs as a result of elevated OS. 140 Evidence suggests that MDD is associated with the immune response, as shown by increased levels of IL-1β, TNF-α, and IL-6. 141 LPS-induced astrocyte activation also contributes to the symptoms of MDD. Systemic treatment with LPS induces depressive-like behaviors and increases the production of inducible nitric oxide synthase (iNOS), IL-1β, TNF-α, and GFAP in the hippocampus and cortex. Inhibition of activated astrocytes reduces neuroinflammation. These alterations are followed by amelioration of LPS-induced depressive-like behaviors. 142

Neurotrophic factors

In the vast majority of patients with severe depression, antidepressants affect the levels of neurotrophic factors. For example, the primary regultaory factor of neuronal survival, growth, and differentiation during development is BDNF. For the treatment of depression, targeting signaling transduction by BDNF and its receptor, tropomycin receptor kinase B (TrkB), is essential. 143 , 144 Recent research has shown a link between decreased hippocampal neurogenesis and low levels of BDNF and glial-derived neurotrophic factor (GDNF) in the brains of depressed individuals. 145 Under normal conditions, astrocytes release various nutrients and cytokines. After cell reactivation, the secretion of these factors is further increased. 146 According to previous studies, fluoxetine stimulates c-Fos expression and ERK 1/2 phosphorylation, which in turn promotes BDNF production in astrocytes sorting from GFAP-GFP transgenic mice. 147 Imipramine acts as an antidepressant by increasing the mRNA expression of BDNF in astrocytes. Fluoxetine also induces BDNF expression by activating cAMP-response element binding protein(CREB) through the PKA and/or ERK pathways. 148

BDNF is an essential molecule for neural plasticity and development and is related to several CNS diseases. Currently, it is known that BDNF can regulate the activity of neurons and that it is produced not only by neurons but also by astrocytes. 149 SSRIs and tricyclic antidepressants increase BDNF expression in cultured primary astrocytes, and BDNF overexpression in mouse hippocampal astrocytes is sufficient to promote neurogenesis and causes anxiolytic behavior. 149 By promoting neurotransmitter release, facilitating vesicle docking, and upregulating the expression of synaptic vesicle proteins, BDNF, which is released by astrocytes in response to long-term antidepressant therapy, may assist in increasing synaptic plasticity at presynaptic terminals. 150 In addition, astrocyte-secreted BDNF can stimulate adult hippocampal neurogenesis and may contribute to synaptic and structural plasticity that underlies the long-lasting behavioral effects of antidepressants. 150 Astrocytes can secrete numerous nerve growth factors. Vascular endothelial growth factor (VEGF) is a member of the vasoactive growth factor family. It exerts its unique molecular effects by binding and activating endothelial cell tyrosine kinase receptors. VEGF is traditionally associated with angiogenesis and its stimulation. Recent evidence indicates, however, that it also influences nerve cells and plays a crucial role in hippocampal neurogenesis and neuroprotection. 151

Inflammasomes

Neuroinflammation is a central pathophysiological mechanism and defining characteristic of MDD. Numerous elements in the periphery and CNS interact to generate neuroinflammation, thereby stimulating astrocytes. The nucleotide-binding domain and leucine-rich repeat protein-3 (NLRP3) inflammasome is one of the largest typical inflammasomes discovered thus far. It is composed of pro-Casp-1 protein, NLRP3, and apoptosis-associated speck-like protein (ASC). 152 The sensitization of the NLRP3 inflammasome and the suppression of BDNF synthesis result in MDD. 153 In our research, SD is found to reduce BDNF levels and induce depressive-like behaviors in the sorted astrocytes from GFAP-GFP transgenic mice by activating the NLRP3 inflammasome. 130 NLRP3 inflammasome activation causes astrocytes to produce more IL-1β and IL-18. 154 , 155

The release of proinflammatory cytokines is the primary consequence of the activation of caspase-1, a component of the NLRP3 inflammasome. In addition, it has been observed that stimulating NLRP3 inflammasome assembly can induce depression-like behaviors in rodents exposed to LPS or CUMS. 156 , 157 Research on the effect of astrocyte-specific NLRP3 knockout suggests that the astrocytic NLRP3 inflammasome exerts a significant effect on astrocytic pyroptosis via the Casp-1/GSDMD pathway in depression. 156 , 157 Therefore, efficient NLRP3 inflammasome inhibitors are novel therapeutic agents for MDD. As we previously reported, chronic SD can specifically activate the NLRP3 inflammasome and decrease the level of BDNF in astrocytes to ameliorate depressive-like behaviors. Fluoxetine can suppress the effects of SD on astrocytes by stimulating astrocytic 5-HT 2B receptors directly. 147 Additionally, in the middle cerebral artery occlusion (MCAO) stroke model of mice, Li + can significantly attenuate GSDMD-mediated glial pyroptosis by regulating the AKT/GSK3β/TCF4/β-catenin signaling pathway, in which, the activation of AKT induced by Li + can also increase the phosphorylation of FoxO3a and promote the transportation of FoxO3a from nucleus into cytoplasm, the reduced FoxO3a in nucleus dissolves its competition with TCF4 in order to confirm more β-catenin/TCF4 complex. The increased latter complex further up-regulates the expression and activation of STAT3 in nucleus, the latter further inhibits the activation of the NLRP3 inflammasome by increase UCP2 which can decrease the production of ROS from mitochondrion. 136 This neuroprotective mechanism of Li + after ischemia-reperfusion injuries contributes to the improved depressive-like behaviors, besides of motor and cognitive capacities. 136

In conclusion, there have been so many hypothesis to explain the pathogenesis of MDD associating with many booming researches (Fig. 3 ). However, it is still hard to adopt only one above hypothesis to completely reveal pathophysiology of MDD. The main problem may contribute to the limitations of the theoretical perspective and the limitations of detection methods. Some key scientific problems in the neurobiology of neurological and psychiatric disorders are still unclear, such as how to identify the pathological characteristic changes for mood disorders, how to metabolize the cerebral metabolic waste under the pathological condition,how to observe the instant interactions of neural cells and the real-time changes of intracellular organelles in the patients of MDD? In the pathological conditions, conducting research from the perspective of comprehensive collaboration of the whole body and increasing the proportion of new technological applications in research will open up the new paths to reveal the pathogenesis of MDD in the future.

The molecular signaling schematic of cytokine hypothesis in the pathogenesis of MDD. The rodent performed the depressive like behaviors are impaired by some widely accepted risk factors, such as long-term sleep deprivation (SD), oxidative stress, lipopolysaccharide (LPS), ischemic damage and so on. Long-term SD can increase the extracellular ATP level, the latter inhibits the activation of AKT and the followed phosphorylation of FoxO3a by stimulating P2X7 receptors (P2X7R), the dephosphorylated FoxO3a translocates into the astrocytic nucleus, then the increased FoxO3a decreases the expression of 5-HT 2B R expression, which results the reduced phosphorylation of STAT3 which increases the activation of cPLA2 and the followed release of arachidonic acid (AA) and prostaglandin E2 (PGE2), finally causing the depressive-like behaviors. 41 Thus, antidepressant fluoxetine activates ERK 1/2 /cFos pathway by stimulating 5-HT 2B R and AC/cAMP/PKA pathway by activating GPCRs in order to increase the activation of CREB and the level of BDNF and TrkB, which can alleviate the depressive like behaviors induced by long-term SD. 147 , 148 As well as, imipramine, other SSIRs, and TCAs can also play antidepressive roles by increasing BDNF mRNA expression in astrocytes. 148 Ischemic stroke can trigger the increase of reactive oxygen species (ROS) which can induce the activation of NLRP3 inflammasome and the release of IL-1β/18, resulting in the neuroinflammation, however, Li + salt inhibits the activation of GSK3β and increases the phosphorylation of FoxO3a by activating AKT, which promotes the more FoxO3a transportation from nucleus into cytoplasm, and the reduced FoxO3a in nucleus lacks the competition with TCF4, the increased complex level of β-catenin and TCF4 further stimulates the expression and the phosphorylation of STAT3, which further induce the mRNA and protein expression of UCP2, then in mitochondrion, the increased UCP2 suppresses the production of ROS and results in the deactivation of NLRP3 inflammasomeincreases. 136 Superoxidation of Fe 2+ stimulates an increase in ROS, resulting in the production of inflammatory cytokines (including IFN-γ, TNF-α, IL-1β, IL-6) and inducible nitric oxide synthase (iNOS). 138 While, the treatments of oxidative stress (OS) can produce a large number of ROS, such as OH• and H 2 O 2 , resulting in neuronal impairments, while astrocytes can play their neuroprotective role by antioxidation. 135 Additionally, LPS can also increase TNF-α, IL-1β, and IL-6 by TLR-4/NFkB/AP-1 pathway and cause depressive-like behavior. 142 Adobe Illustrator was used to generate this figure

Interactions of multi-cells and multi-organs

Recently, increasing evidence has shown that pathological changes in a single cell type or brain region limited are insufficient explain the pathogenesis of MDD. This section mainly introduces the latest research on the pathogenesis of MDD, discussing the multiple interactions among neural cells and the multiple regulatory mechanisms between the brain and peripheral organs in detail.

The interaction between neuron and glial cell

Over the past few decades, studies on MDD have identified decreased PFC activity and excitatory/inhibitory (E/I) imbalance as probable mechanisms underlying depression. 158 Astrocytes are recognized to be essential for controlling neural network activity and to take part in higher brain activities. 159 To explore efficient treatments for MDD, it is important to focus on how to regulate the E/I balance and neuronal remodeling. 160

MDD-related marker proteins in neural cells

Astrocytes in the CNS form the neurovascular unit with neurons and blood vessels. The neurovascular unit mediates the exchange of nutrients and other functional substances between its components. 161 The blood-brain barrier (BBB) consists of endothelial cells tight junctions, a continuous basement membrane and astrocytic end-feet. Two proteins expressed on astrocytes, connexin 30 (Cx30) and Cx43, have been linked to the pathogenesis of depression. 162 Gap junctions that enable communication between astrocytes are formed by the membrane proteins Cx30 and Cx43. 163 Chronic unpredictable stress (CUS) and acute stress both specifically reduce the expression of the gap junction-forming proteins Cx30 and Cx43, 164 and the integrity of the BBB is weakened in mice lacking Cx30 and Cx43. 165

In addition to being an essential component of the developing astrocyte cytoskeleton, GFAP serves as the main intermediate filament protein in adult astrocytes. Although increased expression of GFAP is commonly observed in reactive astrogliosis, postmortem results suggest that the frequency and intensity of reactive astrogliosis are decreased in the brains of patients with MDD. 166 Accompanied by a decreased astrocyte density, the levels of GFAP and the GFAP intermediate filament domain are also reduced in brain samples from patients with MDD. 167 Researchers have even proposed that the GFAP content in serum can be used to determine the severity of MDD, 168 but this point is controversial.

AQP4, a kind of water channel, is mainly expressed on astrocytic end-feet in contact with blood vessels. The water channel AQP4 regulates the equilibrium of ions and water in the brain and is an essential part of the neurovascular unit. The vascular coverage of AQP4-immunopositive astrocytes in the orbitofrontal cortex (OFC) is lower in people with clinically significant depression than in psychiatrically healthy control patients. 169 In another postmortem study, it was found that the coverage of blood vessels by AQP4-positive astrocyte terminals was reduced in the OFC of MDD patients. 170 In addition, the K + -buffering capacity and presumably synaptic transmission are impaired in mice lacking AQP4, and impairment of these processes is associated with depressive-like behaviors. 171 In our previous study, we reported that the expression of AQP4 was decreased by exposure to CUMS, which contributed to dysfunction of glymphatic circulation and depressive-like behaviors in mice. 172 Additionally, the coverage of blood vessels by AQP4-positive astrocytic endfeet is decreased by 50% in MDD patients, indicating that decreased levels or mislocalization of AQP4 may contribute to the pathogenesis of MDD. 169 , 173

S100B is produced and secreted by astrocytes in the gray matter, 174 and changes in the levels of S100B in the blood and cerebrospinal fluid (CSF) of patients with MDD can cause glial cell dysfunction and damage. 175 , 176 In individuals with MDD, the number of S100B-immunopositive astrocytes in the pyramidal layer of the bilateral hippocampal CA1 region is decreased. 177 S100B secreted by damaged astrocytes can enter the extracellular space and CSF, 178 and the level of S100B is increased in the dorsolateral prefrontal cortex (dlPFC) of patients with MDD. 179 S100B levels are elevated in the CSF or serum of patients with MDD, 180 which suggests that S100B is a potential diagnostic biomarker for depressive episodes associated with MDD.

Communication between neurons and microglia plays an important role in the pathogenesis of depression. C-X3-C Motif Chemokine Ligand 1 (CX3CL1)- C-X3-C Motif Chemokine Ligand 1 receptor (CX3CR1) and OX-2 membrane glycoprotein (CD200)-OX-2 membrane glycoprotein receptor (CD200R) form ligand-receptor pairs, and these molecules are the most important chemokines and clusters of differentiation in maintaining CNS homeostasis. 181 CX3CL1 and CD200 are mainly expressed in neurons, and their receptors CX3CR1 and CD200R are expressed on microglia. 182 Activated microglia and decreased expression of CX3CL1 in the hippocampus were observed in an LPS-induced depression model. 183 CX3CR1-deficient mice show a temporary decrease in the number of microglia and a resulting deficiency of synaptic pruning, which may be related to neurodevelopmental and neuropsychiatric disorders. 184 However, CX3CR1-deficient mice show significant resistance to stress-induced depressive-like behaviors. 185 The level of CX3CL1 in the serum is increased in patients with moderate-severe depression compared with healthy subjects; thus, CX3CL1 could be used as a target for depression treatment. 186 Patients diagnosed with MDD with comorbid cocaine addiction show higher serum levels of CX3CL1. 187 Additionally, in a rat early-life social isolation (ESI) model, the expression of CD200 receptors in microglia is significantly reduced. 188 Exposure to unavoidable tail shock causes a decrease in CD200R expression in the hippocampus and amygdala, 189 and stress was also discovered to suppress CD200R expression in the hippocampus of rats. 190

Synaptic plasticity

Long-term potentiation (LTP) serves as the physiological basis for learning and conditioned responses. 191 Ketamine has a quick antidepressant effect, as it is a noncompetitive channel blocker of N-methyl-D-aspartate receptors (NMDARs). 192 Excessive glutamate in the synaptic cleft activates synaptic metabotropic glutamate receptors (mGluRs), which lead to neural excitotoxicity. 193 In a mouse model of chronic social defeat stress (CSDS), which causes depression, mGluR5 was shown to induce long-term depression (LTD). The major process responsible for synaptic plasticity is the mGluR-mediated LTD, which likely plays a significant role in the pathophysiological changes underlying depressive-like behaviors in the CSDS-induced depression paradigm. 194

ATP can mediate the activity of the astrocyte-neuron network, and ATP is a signaling molecule that also controls synaptic plasticity. 195 ATP can increase the expression of amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptors (AMPARs) by stimulating P2X 7 R and increasing the amplitude of miniature excitatory postsynaptic currents. 196 Stress exposure is a major pathogenic factor in disease models and can increase Ca 2+ -dependent release of ATP from neurons, which causes excitotoxicity. 197 , 198

Regulated in development and DNA damage response-1 (REDD1) is a stress response gene that can regulate development and the response to DNA damage. Virus-mediated overexpression of REDD1 in the rat PFC is sufficient to cause anxiety- and depressive-like behaviors and neuronal atrophy. 199 According to postmortem studies, the volume of the dlPFC is smaller and the density of neurons in the dlPFC is lower in MDD. 200 BDNF can modulate synaptic plasticity in the brain. TrkB is a functional receptor of BDNF. 201 BDNF produces antidepressant-like effects by increasing synaptic plasticity in a mouse model of CUMS. 202

Neuron-glia integrity

The term “tripartite synapse” was initially used to describe the intimate relationship between astrocytes and neurons at glutamatergic synapses, similar to the glutamate-glutamine cycle described above. 203 Moreover, glutamic acid decarboxylase, an enzyme that transforms glutamate into γ-aminobutyric acid (GABA), also exists in inhibitory GABAergic neurons. Increased inhibitory neurotransmission, glutamatergic/GABAergic E/I imbalance, and chronic stress-related emotional dysfunction reduce PFC activity. 204 , 205 In local circuits, various glutamatergic and GABAergic neurons interact in complicated ways to achieve E/I balance. 206 A meta-regression analysis indicated that glutamine and glutamate levels are decreased in the PFC, which is correlated with the therapies to MDD. 207 Global topological E/I imbalance in MDD is discovered through gene and protein expression of molecules related to inhibitory GABAergic and excitatory glutamatergic signaling in the postmortem MDD brains. 22 , 208 , 209 It shows the imbalance in cortical-subcortical limbic regions with decreased GABAergic signaling and increased glutamatergic signaling. 210 , 211 Meanwhile, GABAergic signaling is decreased in regions comprising the default mode network (DMN), while it is increased in the lateral prefrontal cortex (LPFC). 212 , 213 Stimulating P2X 7 R in neocortical nerve terminals can block the reuptake of GABA and glutamate by the presynaptic membrane and promote the release of these two neurotransmitters in the cerebral cortex of rats and humans, 214 , 215 and activation of P2X 7 R reduces the expression of GLAST. 216 This results in neuronal damage, a reduced number of synapses, decreased neurogenesis, and even impairment of key cerebral circuits that regulate mood.

Astrocytes are fundamental elements in synapses, participate in synaptogenesis and maturation, and maintain synaptic homeostasis. Ionic homeostasis in the extracellular space is critical for central nervous system function. 217 Astrocytes play an important role in maintaining extracellular K + homeostasis in the CNS, as well as H + , Cl - , and Ca 2+ homeostassis. 218 In addition, it also plays an important role in maintaining transmitter homeostasis, in which glutamate and GABA play particularly important roles. 219

In addition to the tripartite synapse, the more recent concepts of the four-part extracellular matrix and the microglial five-part synapse 220 also support the idea that glial dysfunction plays key roles in the early pathological features common to psychiatric disorders. 221 , 222 Under physiological conditions, microglia can play a neuroprotective role by producing cytokines. However, under pathological conditions, microglia can also affect the balance between excitatory and inhibitory synapses by phagocytosing synapses 223 and activating inflammatory factors in microglia. 224 In addition, the extracellular matrix (ECM) plays a significant role in maintaining normal communication in mature neural networks, which can limit the synaptic restriction of glutamate. 225 The components of the ECM are mainly produced by neurons and astrocytes, and microglia can also regulate the remodeling of the ECM. 226

Interaction mechanism in multi-organs

Abnormalities in cytokine levels in the brain and peripheral organs, disruption of the brain/immune system balance, and dysfunction of communication between the peripheral organs and the brain can cause neuroinflammation and depressive symptoms. For instance, cirrhosis and depression have been linked to intestinal dysbiosis, which results in intestinal barrier disruption, increasing bacterial translocation. Increased bacterial translocation then activates circulating immune cells, which produce cytokines and induce systemic inflammation. 227 In comparison with the healthy population, MDD patients have a much higher incidence and prevalence of chronic liver disease. 228 Inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS) with increased intestinal permeability, which may have both inflammatory and autoimmune sources, are common comorbidities of MDD and anxiety. 229 , 230

Neuroendocrine-immune axis

Microglia secrete chemokines that disrupt the integrity of the BBB and increase the ability of immune cells to enter the brain parenchyma. 231 The stress response is a complex array of behavioral, neuroendocrine, autonomic, and immunological responses that enable adaptation to unpleasant psychological and physiological stimuli. 232 The HPA axis is a crucial endocrine system that orchestrates this response. 233 Stress can activate microglia, which are considered important immunocytes of the CNS. Mediators released by activated microglia can stimulate the HPA axis and induce GC production. 39 Similarly, high levels of GCs can also activate microglia, creating a vicious cycle. 234

Tryptophan (TRP) can be converted into a variety of biologically active molecules, and more than 95% of TRP is metabolized to kynurenine (KYN) and its breakdown products, with only a small portion of TRP being converted to 5-HT. 235 Indoleamine 2,3 dioxygenase (IDO) is an immune inducible enzyme that metabolizes TRP through the KYN pathway and plays an important role in the immune response. 236 In the brain, KYN is metabolized to the neurotoxic substance quinolinic acid (QUIN). 237

The primary GC in the HPA axis, corticosterone, plays a role in regulating the stress response in rodents. Stress, high GC levels, and serious depression are all linked. Analysis of transcriptomic changes associated with corticosterone-induced cytotoxicity revealed an association of neurite outgrowth-related genes with depression. Therapies for MDD may target the expression of genes involved in neurite formation, such as calpain 2 (Capn2), vesicle-associated membrane protein (Vamp7), and c-type natriuretic peptide (Cnp). 238

Consumption of a high-fat diet (HFD; for approximately 16 weeks) results in anxiety and anhedonic behaviors, and 4 months of HFD consumption results in increased levels of corticosterone and blood glucose, which also activate the innate immune system, increasing the release of inflammatory cytokines (i.e., IL-6, IL-1β, TNF-α). The behavioral abnormalities that arise from long-term consumption of a HFD are quickly reversed by ketamine. Additionally, giving HFD-fed rats a P2X 7 R antagonist greatly alleviates their anxiety. 239

Microbiota-gut–brain axis

In recent years, the microbiota-gut-brain axis has been reported to be disrupted in MDD. Stress stimulation can affect the gut microbiota, which in turn induces the production of inflammatory mediators (mainly IL-6 and IFN-γ) and a reduction in short-chain fatty acid levels. 240 The increased level of inflammatory cytokines may be caused by disturbance of the gut microbiota, which may also disrupt the gut barrier. 241 Alterations in the gut microbiota and inflammatory agents have an impact on the KYN pathway, metabolism, and toxin metabolism in the periphery. 242 Proinflammatory cytokines or toxic byproducts resulting from microbiota alterations may pass through the BBB and enter the brain. 243 This increases the levels of cytokines such as IL-1β and IL-6 and NLRP3 inflammasome activation in brain-resident cells. 244 In particular, microglia and astrocytes are activated and undergo atrophy, respectively. These glial cell changes, which affect the brain networks involved in learning and memory, mood regulation, and emotional regulation, may cause depressive symptoms or anxiety episodes. 245

According to clinical research, TRP and tryptophan catabolites (TRYCATs) may play a crucial role in psychiatric illnesses, including MDD. Peripheral and central inflammation can both stimulate the KYN pathway and trigger TRP metabolism and subsequent synthesis of various TRYCATs, including the toxic NMDAR activator QUIN, 246 which influences glutamate transmission, has a variety of immunomodulatory effects and has both neurotoxic and neuroprotective effects on the CNS. 141 Studies have proven that peripherally injected LPS increases the central and peripheral metabolism of TRP via the KYN pathway by exerting neurotoxic effects, inducing reactivation of microglia and astrocytes in the CNS. 247 Excessive production of QUIN, an NMDAR agonist, stimulates the release of glutamate and inhibits reuptake, leading to neuronal excitotoxicity. 248

Liver-brain axis

Patients with liver diseases often struggle with depression. According to one study on the frequency of liver disease and major depression in the United States, liver disease is linked to both major depression and suicidal thoughts. 249 A further population-based cohort study discovered that patients with MDD had much higher prevalence and incidence rates of chronic liver disease than the general population. 228 The incidence of depression is high in cirrhosis patients; moreover, depression is an independent predictor of mortality from cirrhosis. 250

An internal metabolic mechanism regulated by the liver can control depressive-like behavior. A crucial enzyme in epoxyeicosatrienoic acid (EET) signaling in the liver is epoxide hydrolase (sEH). Chronic stress selectively exacerbates sEH-induced depression-related changes in the liver while dramatically lowering the plasma levels of 14,15-EET. Deletion of hepatic epoxide hydrolase 2 (Ephx2) (which encodes sEH) rescues the chronic mild stress (CMS)-induced decrease in 14,15-EET plasma levels. 251 In a rat model of CUMS, electroacupuncture (EA) was found to downregulate P2X 7 R, NLRP3, and IL-1β expression in the prefrontal cortex and liver and relieved depression-like behavior. 252

In summary, as shown in Fig. 4 , although the etiology of MDD is still unclear, it is widely accepted that the common pathogenic factors of MDD are genetic, stress, and comorbidity. 3 The levels of monoamine neurotransmitters (5-HT, NE, and DA) are insufficient in the synaptic cleft of MDD patients, correspondingly, the explored antidepressants such as tricyclic antidepressants(TCAs), SSRIs and SNRIs almostly act on the channels responsible for inhibiting reuptake of these neurotransmitters. 51 Thus, according to these traditional pharmacological theories, these antidepressants always have the delayed clinical efficacy, this promises the potential new pharmacological mechanism still requires further study. As the well-known glutamate-glutamine cycle, astrocytes play key roles in resolving neuronal glutamate toxicity. However, under the MDD pathological condition, due to the decreased expression of EAATs in astrocytes, excessive glutamate in the synaptic cleft activates synaptic mGluRs, which leads to neuronal excitotoxicity. 194 In addition, the overdose glutamate can also be decarboxylated by glutamate decarboxylase (GAD) to GABA and activates the GABA receptors on the postsynaptic membranes. 206 In our previous studies, the expression of 5-HT 2B is selectively decreased in the sorting astrocytes from MDD model mice. 64 The antidepressants SSRIs and leptin can increase the expression of the astrocytic 5-HT 2B receptor. 147 Furthermore, OS plays a crucial role in the emergence of depression, including by elevating the levels of ROS and NO in the mitochondrion of astrocytes. 253 Proinflammatory signaling pathways are activated as a result of elevated OS, the mitochondrial dysfunction results in an increased generation of ROS and NO. 137 As well as, the pathogenesis of MDD are associated with the inflammatory-immune response, as shown by elevated levels of proinflammatory cytokines, mainly IL-1β, TNF-α, and IL-6. 141 The expression of neural cell marker proteins in neural cells, including Cx30/43, 162 GFAP, 167 AQP4, 172 and S100B, 177 are all decreased under MDD pathological conditions. In brain, KYN is metabolized by microglia to the neurotoxic metabolite QUIN and by astrocytes to the beneficial metabolite kynurenic acid (KynA), thus, QUIN is increased and KynA is decreased in MDD patients’ brain. 141 , 254 , 255 Recently, growing evidence support that the occurrence of MDD are the results of the correlational disorders from multiple systems or organs, not only limiting in brain. 227 , 228 The comorbidities of MDD have attracted widespread attention, the intestinal gut microbial dysbiosis, liver dysfunction, immune system disorders all play important roles in the pathogenesis of MDD. Stressful conditions can affect the gut microbiota, which in turn induces the production of inflammatory mediators (mainly IL-6 and IFN-γ). 256 Proinflammatory cytokines or toxic QUIN resulting from alterations in the microbiota may pass through the BBB and activate NMDARs. 243 Under the dysfunction of liver, the level of ammonia is increased in the brain. 257 The pathogenic factors of various organs at the body level and the pathological changes of glial cells at the cellular level should attract more attention to explain the pathogenesis of MDD.

The pathogenesis of MDD is closely related to synapses, astrocytes, microglia, and their interactions as well as interactions among organ. Genetic factors, stress and comorbidities are considered the most common pathogenic factors of MDD 3 . The traditional monoamine theory contends that MDD may cause by the deficits in monoamine neurotransmitters. 49 Moreover, the other abnormal increase of neurotransmitters in the synaptic cleft, such as glutamate, GABA and ATP, has the high relationship with the pathogenesis of MDD. 41 , 496 The interaction between neurons and glial cells can induce the oxidative stress, pro-inflammatory cytokines released, the reduction of neurotrophic factors. The microbiota-gut-brain axis is clearly disrupted in MDD. 243 , 248 When liver dysfunction occurs and causes OS and neuroinflammation in the brain, which also contribute to the pathophysiology of MDD. 497 Adobe Illustrator was used to generate this figure

New diagnostic approaches

MDD is a prevalent psychiatric disorder worldwide and is expected to become one of top disease in terms of burden by 2030. 258 However, the current clinical diagnostic criteria for MDD are subjective, and diagnoses are mainly based on clinical symptoms, leading to high rates of missed and incorrect diagnoses. This section summarizes the newest research on diagnostic approaches for MDD, including serum indicators, neuroimaging indicators and multimodality scales. Research on new diagnostic approaches for MDD has the potential to improve our understanding of MDD pathogenesis and the accuracy of clinical diagnosis.

Potential serum indicators

The pathological mechanism of MDD can be studied in two ways: by exploring the pathophysiology of the disease and by identifying MDD-related neurobiological indicators4. Hence, identifying potential biomarkers for MDD could allow accurate diagnosis, faster treatment and effective monitoring of the disease. Recently, an increasing number of studies have confirmed the involvement of OS and neuroinflammation in MDD pathology. 259 , 260 Two novel biomarkers, serum nicotinamide adenine dinucleotide phosphate oxidase 1 (NOX1) and Raftlin, are reported to have good diagnostic value in MDD patients. The effectiveness of elevated NOX1 and Raftlin levels in diagnosing MDD has been evaluated in clinical trials; the related mechanism is that NOX1 can regulate the ROS-antioxidant balance in patients with MDD through OS and the inflammatory repsonse. 261 The serum level of the chemokine-like protein TAFA-5 (FAM19A5) has also been reported to be increased in patients with MDD, and increased serum FAM19A5 levels are associated with reactive astrogliosis, neuroinflammation, and neurodegeneration. 262 In addition, the level of serum FAM19A5 was shown to have a negative correlation with cortical thickness in specific brain regions. These findings suggest that serum FAM19A5 could be a potential biomarker for neurodegenerative changes in MDD.

Functional magnetic resonance imaging indicators

In addition to serum indicators, neuroimaging metrics are potential objective tools for improving the accuracy of MDD diagnosis and must be studied in death. In recent years, many researchers have tried to diagnose MDD using MRI by identifying disease-specific functional and/or structural abnormalities in patients with MDD compared with healthy subjects. 263 Structural MRI techniques, such as voxel-based morphometry (VBM), can be used to detect volume changes in gray matter. 264 It has been reported that abnormal gray matter volume (GMV) in several brain regions is positively correlated with MDD. 265 , 266 Regarding functional MRI, recent studies have revealed that cerebral functional abnormalities are not limited to specific brain regions in patients with MDD. These differences are also associated with hypoconnectivity within the frontoparietal network (FN), the DMN, and midline cortical regions. 267 , 268 Furthermore, resting-state functional magnetic resonance imaging (R-fMRI) is an emerging neuroimaging technique used to study functional connectivity in the brain and holds great potential in aiding clinical diagnosis. 269 It has the benefits of being noninvasive and easy to perform and offering high temporal and spatial resolution. 270 As a result, it has played a significant role in MDD research and is a superior technique for researching MDD pathogenesis and identifying neuroimaging markers for MDD. 271 Thus, indicators such as amplitude of low-frequency fluctuation (ALFF), fractional amplitude of low-frequency fluctuation (fALFF), regional homogeneity and functional connectivity (FC) have shown promise as neuroimaging markers for MDD. Recently, a study reported that increased average values of ALFF and fALFF in the right caudate and corpus callosum may serve as potential markers for diagnosing MDD. 272 Another study based on the largest R-fMRI database of MDD patients confirmed that the DMN plays a crucial role in MDD diagnosis, as DMN FC is reduced in patients with recurrent MDD. 273 These findings also suggest that the DMN should continue to be a prominent focus of MDD research.

New multi-modal evaluation scales

Given that structural and functional abnormalities are associated with MDD, 274 using multimodal approaches is more appropriate than relying on a single feature for the diagnosis of MDD. However, research results related to the effectiveness of neuroimaging techniques in diagnosing MDD remain inconsistent. 275 This may be attributed to variations in the types of structural and functional features examined; however, more importantly, very few studies have used multimodal approaches to diagnose MDD. 276 Recently, in a study utilizing multimodal MRI data, patients with MDD were successfully distinguished from healthy controls by radiomics analysis. 276 Radiomics is a rapidly developing field involving the extraction of quantitative information from diagnostic images, and it can be mainly divided into three steps: image acquisition, analysis and model building. 277 Additionally, omics and neuroimaging techniques can be combined to construct models for diagnosing MDD; specifically, 5-hydroxytryptamine receptor 1 A/1B methylation data can be integrated with resting-state functional connectivity (rsFC) data. It was shown that this combination could be used to more accurately distinguish patients with MDD from healthy subjects than R-fMRI data or DNA methylation data alone. 278

By now, the widely accepted objective diagnostic indicators or methods for MDD are still deficient. In addition to the unclear pathogenesis of MDD, insufficient sensitivity and accuracy of detection instruments are also the main reasons, especially the correlation between imaging characterization and disease-specific changes that need to be discussed.

Preventing the occurrence and recurrence of MDD

MDD is a disease with a high prevalence worldwide, 279 and preventing its occurrence and recurrence is crucial. Lifestyle medicine is an evolving medical specialty that aims to prevent chronic, noncommunicable diseases through lifestyle interventions. The goal of lifestyle medicine is to prevent the occurrence and recurrence of disease by improving sleep hygiene and diet, increasing physical exercise, avoiding sedentary behavior, increasing social support, and improving mood. In recent years, an increasing number of studies have demonstrated that the occurrence and recurrence of MDD can be prevented by means of lifestyle medicine; 280 we summarize these reports in this section.

Sleep improvements

Improving sleep is an important strategy to prevent the occurrence of depression. Insomnia is included in the diagnostic criteria for MDD. 281 However, few studies have examined whether treating insomnia can prevent the exacerbation of depressive symptoms. Treating insomnia can prevent the worsening of depressive symptoms, and cognitive behavioral therapy for insomnia (CBT-I) is a recommended intervention for treating insomnia to improve sleep and mood. 282 , 283 , 284 As a first-line treatment for insomnia, CBT-I includes cognitive therapy, stimulus management, sleep restriction, improved sleep hygiene, and relaxation. 282 , 285 CBT-I can also lead to sustained remission of insomnia-related disorders, and continuous treatment of insomnia with CBT-I can also reduce the occurrence and recurrence of MDD. 286 Circadian rhythm support (CRS) can strengthen the circadian rhythm by means of scheduled bright light exposure, physical activity, and body warming. 287 Although CRS has been reported to have only an indirect effect in alleviating sleep disturbance and depressive symptoms, 288 treatment with CRS may help maintain the beneficial effects of CBT-I. 288 , 289 In one study, 44% of untreated patients but 38%, 28% and 9% of patients treated with CRS, CBT-I, and CBT-I + CRS, respectively, experienced clinically significant worsening of depressive symptoms during a 1-year follow-up period. Between-group comparisons showed that the percentage of patients who experienced worsening of depressive symptoms was significantly different between the CBT-I + CRS group and the nontreated and CRS groups. 289 In a randomized controlled trial, exacerbation of depressive symptoms over one year was decreased in insomia patients with an increased risk of depression and insomnia patients treated by therapist-guided CBT-I combined with CRS; however, untreated insomnia patients with a high risk of depression experienced clinically significant worsening of depressive symptoms. 288 , 289

Disrupted sleep is a common symptom of depressive episodes and increases the risk of MDD, 290 but the correlation between the onset of sleep disturbance and MDD is still unclear. Additionally, patients with symptoms of sleep disturbance have a greater risk of MDD occurrence and recurrence. 290 , 291 One study suggests that disrupted sleep may affect monoamine function and the HPA axis, 292 even causing hyperarousal and inflammation. 293 Additional studies on the pathological mechanism of depression have suggested that the HPA axis is hyperactive in MDD patients and that sensitivity to negative feedback is decreased. 15 Additionally, one prospective cohort study reported that a history of sleep disorders can increase the risk of depression later in life and that subjective sleep problems are associated with clinically significant depressive symptoms. 294

Dietary adjustment

Dietary adjustment is an effective, safe, and widely applicable method for preventing MDD, especially by inhibiting MDD-related pathological inflammation. 295 Various nutrients can possess different anti-inflammatory properties; in contrast, there are many proinflammatory foods, such as those high in refined starch, sugar, and saturated fat and low in fiber and omega-3 fatty acids, 296 which can promote the occurrence of inflammation to increase the risk of MDD. 297 One study reported that the chance of being diagnosed with depression is higher among individuals who consume a proinflammtory diet than among those who consume an anti-inflammatory diet. 295 Stimulation of the innate immune system by proinflammatory foods can result in mild inflammation and chronic illness, which may contribute to an increased risk of MDD. 298 Furthermore, an increasing number of studies suggest that at the molecular and cellular levels, dietary factors have effects on neuronal function and synaptic plasticity, which may be implicated in the etiology of MDD. 299 , 300 Therefore, adherence to a healthier diet can reduce the incidence of MDD, which is of great significance for the clinical treatment and prevention of depression. 295

In addition, an increasing number of studies have identified the importance of the interaction among the microbiota, gut permeability, and immune-inflammatory processes in the pathophysiology of MDD. 301 Because the interaction of bacteria of some taxa in the gut with peripheral inflammation with the brain may be related to depression pathophysiology, 302 , 303 regulating the gut-microbe-brain axis may be a therapeutic and preventive strategy for psychiatric disorders. 304 Restoration of the gut eubiosis can prevent the occurrence of MDD, and probiotics can normalize the gut ecosystem. Additionally, by altering the microbiota and regulating gut permeability, a gluten-free diet can alter the activity of the gut-microbe-brain axis, which has been discovered to be related to the pathogenesis of MDD. 305 , 306 , 307 Other studies report that consuming a gluten-free diet and probiotic supplements together may inhibit the immune-inflammatory cascade in MDD patients, and decreased inflammation can improve the integrity of the gut barrier and alleviate depressive symptoms. 307 Similarly, dietary fiber can also improve immune function by regulating the gut microbiota to prevent the occurrence of MDD, 308 which is attributed to the inhibition of OS and inflammation.

Increasing evidence suggests that physical exercise can prevent some mental disorders in addition to cardiovascular disease. 280 , 309 This finding suggests that physical exercise may be able to prevent MDD. As reported in some studies, physical exercise can effectively prevent depression by affecting many molecular and cellular pathways; for instance, physical exercise can stimulate VEGF expression, 310 , 311 leading to cellular level changes, such as stimulation of angiogenesis, increased delivery of neurotrophic factors and oxygen by the vascular system, 312 an increase in the neurogenesis rate and induction of synaptogenesis. 312 , 313 Ultimately, VEGF improves function in the hippocampus, which is one of the brain regions related to depression and stress regulation. 314 , 315 , 316 Exercise also reduces the levels of proinflammatory factors (e.g., IL-6) and increases the levels of anti-inflammatory factors (e.g., IL-10), which is beneficial for preventing the occurrence of MDD. 317 , 318 , 319 Furthermore, physical exercise for approximately 45 minutes per day can significantly reduce the risk of MDD. 320 , 321 High-intensity activity, such as aerobic exercise, dancing, and the usage of exercise machines, and low-intensity exercises, including yoga and stretching, can all reduce the occurrence of MDD. 322 Specifically, the combination of aerobic exercise and stretching as a multimodal therapeutic strategies has a significant antidepressant effect in depressed inpatients. 323

Patients with MDD have significantly more sedentary than ordinary people, and they engage in less physical activity than what is recommended, i.e., an average of 150 min of moderate- to high-intensity physical activity weekly. 324 This finding suggests that decreasing sedentary behavior or increasing physical activity levels should be a priority to prevent the occurrence of disease. In psychiatric centers, aerobic exercise has received increasing attention as a valuable method of prevention. 324 Studies report that reduced depressive symptoms in MDD patients can be observed after increasing aerobic exercise and stretching exercise, with more significant alleviation of depressive symptoms after 8 weeks of aerobic exercise. 325 Reward positivity (RewP) and error-related negativity (ERN) were identified as potential biomarkers of the exercise treatment response in depression. 325 In individuals with MDD, aerobic exercise was found to be beneficial in ameliorating depressive symptoms, particularly in those with more severe depressive symptoms and a higher baseline RewP. 325 , 326 RewP may be useful for identifying those who will benefit from exercise as a treatment for depression. 325

Social intervention

Social support refers to the help provided by social relations and transactions. 327 Social support may be obtained from a variety of individuals, including family members, friends, coworkers, and community members. 328 Furthermore, a variety of factors, including the quantity and quality of support as well as subjectively perceived social support by individuals, impact the level of social support. 329 It has been reported that MDD patients often lack social support, and receiving adequate social support can confer greater resistance to stress and prevent the occurrence and recurrence of MDD. 330 , 331 Low-functioning social support or self-perceived poor social support causes worse symptoms and treatment outcomes in depressed patients. 332 , 333 , 334 A previous study also reported that patients who lack adequate social support are more likely to experience MDD. 335 Social support may have an influence on depression through neuroendocrine pathways, 336 , 337 and social support can improve a person’s psychological wellbeing and make the individual more resistant to stress. 337

Studies on structural social support, social network size, and mental health disorders have shown that less social contact and loneliness can cause more severe depressive symptoms. 338 For individuals with MDD, it is necessary not only to increase the frequency of social contact but also to improve self-awareness and foster close functional supporttive relationships. 335 , 339 Studies have reported that when controlling for all other variables, each aspect of social support is clearly associated with MDD, and to some extent, the occurrence of panic disorder in patients with MDD is more strongly associated with poor functional support. This finding suggests that functional support may be an important protective factor against MDD. 331 , 335 Social support itself, especially emotional support, 340 may alleviate and prevent depressive symptoms, and support from family members or friends can replace formal health care. 341

In general, the pathological development of MDD is a gradual transition from subclinical state to clinical pathological changes. It is crucial to identify the core targets that lead to pathological changes from quantitative to qualitative changes during this process, and the above preventive interventions, sleep improvement, physical exercise, dietary regulation, and social intervention, may prolong or reverse the subclinical pathological stage (Fig. 5 ).

Schematic of prevention strategies for the occurrence and reoccurrence of MDD. An outline of various prevention strategies for MDD includes sleep improvement, dietary adjustment, exercise, and social intervention. Sleep disturbances have the high relationship with the occurrence of MDD, the anhedonia, anxiety and insomnia are the main symptoms of patients with MDD. The behavioral and educational strategies, cognitive reconstructing therapy and circadian rhythm support can be applied to improve sleep quality. 281 , 289 Dietary adjustments are also suggested to have the potential effects to prevent the occurrence or re-occurrence of MDD, the improvement mechanism of diet may involve in the regulated immune-inflammatory responses, the improved gut-microbe-brain axis and synaptic plasticity. 295 , 299 , 304 In addition, xxercise is an effective way to improve neuroplasticity, to maintain neuroendocrine homeostasis, and to regulate neuroinflammation, in order to effectively prevent the occurrence or re-occurrence of MDD. 280 , 309 Importantly, getting social support from family members, friends, coworkers and community members can be helpful for the MDD patients’ recovery, these social interventions can let patients get emotional support and improve their self-awareness. 328 , 340 Adobe Illustrator was used to generate this figure

Therapeutic drugs and strategies

This section summarizes new advances in research on the pharmacological mechanisms of common antidepressants and novel therapeutic strategies. Moreover, as laboratory animal models of MDD and other mental diseases are lacking, hindering the development of strategies for evaluating pharmacological effects and studying pathological mechanisms, we also discuss recent research on animal models.

The molecular mechanism of antidepressants

Tricyclic antidepressants.

In the late 1950s, the first TCAs were approved and used for the treatment of depression. 342 TCAs have a common three-ring chemical structure, and the main TCAs are imipramine, amitriptyline, clomipramine, desipramine and doxepin. The pharmacological mechanism of TCAs mainly involves its interaction with neurotransmitters in the brain, resulting in changes in neurotransmitter levels and an antidepressant effect. First, TCAs can inhibit the reuptake of neurotransmitters, leading to antidepressant effects. For example, they can influence the levels of 5-HT, NE, and to a lesser degree, DA, causing an increase in neurotransmitter concentrations in the synaptic gap and increasing neurotransmitter signaling to exert pharmacological effects. 343 However, different TCAs inhibit 5-HT and NE reuptake to varying degrees. For instance, amitriptyline, imipramine, and desipramine strongly inhibit 5-HT reuptake, 344 clomipramine specifically inhibits NE reuptake, and nortriptyline can inhibit both NE and 5-HT reuptake while also exerting central anticholinergic effects. 345 , 346 , 347 Additionally, TCAs can antagonize 5-HT 2A and 5-HT 2C , thereby increasing the release of NE and DA in cortical areas. 348 , 349 , 350 TCAs can bind to histamine receptors, especially H1 receptors, as well. 351 By blocking H1 receptors, they can induce sedation and drowsiness, which may benefit depressed patients with sleep disorders. 352 Furthermore, TCAs can also block muscarinic acetylcholine receptors, exerting anticholinergic effects and resulting in side effects such as dry mouth and constipation. 353

In addition to the above-known pharmacological mechanisms, some recent studies have reported that amitriptyline can induce the activation of fibroblast growth factor receptor (FGFR), leading to the production of GDNF. 354 In addition, amitriptyline can increase the expression of Cx43 to promote gap junction intercellular communication (GJIC) between astrocytes, thereby relieving depressive symptoms. 355 This suggests that TCAs may also ameliorate severe depression through additional mechanisms involving astrocytes that are independent of the monoamine system to some extent. Further exploration is needed to fully understand the specific mechanism. Another study demonstrated that FKBP51, a crucial modulator of the glucocorticoid receptor (GR) pathway, can bind to clomipramine and impede its interaction with PIAS4. Inhibition of this interaction subsequently hinders sumoylation; this alteration represents a newly discovered mechanism by which the antidepressant drug exerts its effect. 356

Selective serotonin reuptake inhibitor

According to a study, most severe depression patients are still advised to consider SSRIs as the initial choice for treatment. 350 The main representative SSRIs drugs include fluoxetine, sertraline, paroxetine, and escitalopram. The mechanisms of action of SSRIs are commonly known as follows: first, SSRIs can selectively inhibit SERT, inhibiting the reuptake of 5-HT in the synaptic cleft and thereby exerting pharmacological effects. 357 Second, SSRIs can impact the 5-HT signaling pathway, activating 5-HT 1A. 358 , 359 In addition, studies have shown that antagonism of 5-HT 2A/2C receptors can enhance the effects of SSRIs such as fluoxetine. 360 , 361 Third, long-term use of SSRIs can increase 5-HT transmission in the LC, 362 thereby increasing the release of GABA to exert inhibitory effects on NA neurons. 363 Fourth, long-term use of SSRIs is associated with neuroplasticity and neurogenesis in certain brain regions. 364 SSRIs have been found to increase the expression of BDNF, a protein crucial for neuronal growth and survival, by acting on TrkB, 365 which may contribute to the long-term therapeutic effects of SSRIs. Thus, our previous reports and others researches all suggested that astrocytic 5-HT 2B receptors may be the potential pharmacological target of SSIRs. 59 , 60 , 366 , 367 , 368

According to previous studies by our group, in the absence of SERT, SSRIs such as fluoxetine can act as direct agonists of astrocytic 5-HT 2B receptors to exert antidepressant-like effects. 60 , 64 , 179 , 366 , 369 In astroglia isolated from mice exposed to CUMS, fluoxetine activates the 5-HT 2B receptor, promoting ERK 1/2 phosphorylation. This increases downstream c-Fos expression, which in turn boosts BDNF synthesis. 147 Furthermore, administration of fluoxetine effectively inhibits SD-induced stimulation of the NLRP3 inflammasome by the AKT/STAT3 and ERK/STAT3 pathways in vivo, and SD dramatically triggers depressive-like behaviors by stimulating astrocytic P2X 7 Rs. 41 , 155 As previously mentioned, leptin may increase the expression of the 5-HT 2B receptor in astrocytes via the LepR/JAK2/STAT3 pathway, and fluoxetine may be more effective in increasing BDNF levels and alleviating depressive-like behaviors due to the leptin-mediated increase in 5-HT 2B receptor expression. 130 Both in vivo and in vitro, fluoxetine’s inhibitory actions on A1 reactive astrocytes depend on astrocytic 5-HT 2B R. 55 Recently, fluoxetine was shown to act as a 5-HT 2B agonist, and this finding is also supported by research by other groups. Fluoxetine has been reported to suppress the activation of A1 reactive astrocytes and decrease unusual behaviors in CMS-exposed mice. In vitro, Gq protein and b-arrestin1 are not necessary for fluoxetine’s effects on A1 astrocyte activation, and downstream signaling through astrocytic 5-HT 2B R is responsible for fluoxetine’s inhibitory effects on A1 astrocyte activation in primary culture. 55

Serotonin/norepinephrine reuptake inhibitors

SNRIs are often recommended as the initial choice for the treatment of MDD. Representative SNRIs include milnacipran, DXT, DVS, and venlafaxine. The molecular mechanisms of SNRIs can be summarized as follows: First, SNRIs inhibit the norepinephrine transporter (NET), which prevents the reuptake of NE into presynaptic neurons, leading to an increased concentration of NE in the synaptic cleft. 370 Second, similar to SSRIs, SNRIs also inhibit SERT, resulting in an increased concentration of 5-HT in the synaptic cleft. 371 For example, paroxetine and venlafaxine can inhibit SERT and, to a lesser extent, NET. 372 Third, SNRIs inhibit the reuptake of both NE and 5-HT; thus, they have a dual mechanism of action. This dual inhibitory effect is believed to contribute to the broader therapeutic effects of SNRIs compared to SSRIs. 373 Chronic treatment with fluoxetine has been shown to increase the expression of Cx43 in the rat PFC, which further prevents the dysfunction of astrocytic gap junctions induced by CUS and reverses the depressive-like behaviors caused by gap junction blockade. 71

In a randomized controlled trial, MRI scan were taken after treatment with duloxetine and desvenlafaxine, and the results showed that the thalamo-cortico-periaqueductal network, which is associated with the experience of pain, may be an important target of action of antidepressant drugs. 374

New potential pharmacological targets

The abovementioned antidepressants have been utilized as clinical therapies for MDD, but it is difficult to elucidate the exact pharmacological mechanisms of every medicine due to delayed clinical efficacy, poor treatment response to some patients, and difficulty in effectively controlling the incidence of suicide. Recently, several pharmacological agents have been discovered as potential antidepressants.

Ketamine, a noncompetitive antagonist of the NMDAR, has been shown to induce rapid and significant antidepressant effects within a few hours. 375 Due to the rapid antidepressant effects of ketamine, unlike the delayed effects of traditional antidepressant drugs, 376 research on this drug has continued and has revealed its mechanisms of action and potential drug targets. Ketamine can increase the level of BDNF in the prefrontal cortex, especially in the hippocampus, to exert antidepressant-like effects. 377 Studies have suggested that ketamine can increase the synthesis of synaptic proteins through BDNF signaling dependent on the activate protein kinase B (Akt) and mammalian target of rapamycin complex 1 (mTORC1) signaling cascades. 378 , 379 Ketamine may induce the activation of mTOR by the upstream kinase Akt, regulate the phosphorylation of GSK-3β, and exert antidepressant effects. 380 Ketamine can block NMDARs in postsynaptic principal neurons in the PFC and hippocampus, increase synaptic function through homeostatic mechanisms, and reverse synaptic defects caused by chronic stress. 381 , 382 Furthermore, by inhibiting NMDARs, ketamine can reduce the excitation of specific cortical GABAergic interneurons, resulting in a temporary increase in glutamate release that stimulates postsynaptic AMPA glutamate receptors. This, in turn, leads to the release of BDNF, activation of the TrkB receptor, and subsequent activation of the Akt/mTORC1 signaling pathway. These molecular events ultimately contribute to an increase in the number and functionality of synapses, leading to amelioration of depressive symptoms. 383

Similar as ketamine, some other psychedelics can also produce fast and persistent antidepressant effects. 384 Psilocybin, a classical psychedelic, can play its antidepressant roles by activating 5-HT 2A receptors (5-HT 2A R). 385 Thus, to block the 5-HT 2A R can not produce the antidepressant effects of psilocybin, only induce the hallucinogenic-like behaviors in mice. 386 This proposes 5-HT 2A R may not be the real pharmacological target for its antidepressant effects. Another study reports that the combination of lysergic acid diethylamide (LSD) and psilocybin may exert long-term antidepressant effects by promoting neural plasticity, which dose not involve in the hallucinogenic effects. 384 Additionally, to target 5-HT 2A R, the combination of LSD and psilocybin can lead to biased activation of the mediated signaling pathway and produce antidepressant effects without the side effects of hallucinations. 387 Thus, the administration of psilocybin can rapidly and persistently induce neuronal dendritic remodeling in the medial frontal cortex of mice, and the psilocybin-induced newly formed dendritic spines can successfully transform functional synapses, suggesting that synaptic rewiring may also be one pharmacological mechanism of the rapid antidepressant effects of psilocybin. 388 To further dissociate the hallucinogens effects from the psychedelics can be beneficial to develop more specific antidepressants with better therapeutic capacities.

Additionally, some novel potential therapeutic targets for MDD have also been reported, such as TGF-β1 389 and growth-associated protein 43 (GAP-43). 390 Multiple studies have shown that antidepressants may cause changes in TGF-β1 expression. Fluoxetine, paroxetine, venlafaxine, and sertraline have been shown to have the potential to increase the levels of TGF-β1, which may contribute to their antidepressant effects. 391 , 392 Venlafaxine has also been reported to exert neuroprotection by increasing the production of FGF-2 and TGF-β1 in astrocytes following stroke. 72 Then, chronic administration of desipramine has been shown to upregulate the expression of GAP-43 in the hippocampus of rats, potentially influencing neuronal plasticity in the CNS. 390 GAP-43 has been suggested as a relevant target for the pharmacological effects of antidepressants. 393 , 394

The most of above antidepressants have been widely used for the MDD patients according to the respective potential pharmacological actions (Fig. 6 ). Thus, the exactly neuromolecular mechanisms require deep studied and the new potential therapeutic targets and strategies still need further exploration.

The molecular mechanisms of tricyclic antidepressants (TCAs), selective serotonin reuptake inhibitors (SSRIs), serotonin/norepinephrine reuptake inhibitors (SNRIs) and ketamine. TCAs can inhibit the protein kinase C (PKC) pathway by blocking the H1 receptors (H1Rs), 351 , 352 TCAs decreases the reuptake of dopamine (DA) by inhibiting dopamine transporters (DATs) in the presynaptic membrane, and increases the DA concentration in the synaptic gap, increase the effect of DA on dopamine receptors (DARs) of postsynaptic membrane. 343 The activated DARs increase Ca 2+ dependent CaMKII and CaMK4, as well as, the secretion of CREB. 498 , 499 In another way, the stimulated DARs by DA can also activate the cAMP-PKA pathway, which in turn activates the levels of CREB and BDNF by stimulating MAPK/ERK 1/2 pathway. 500 TCAs, SSRIs, and SNRIs can all inhibit the reuptake of 5-HT by SERTs, specially SSRIs have the selective inhibition on SERTs, which increase the concentration of 5-HT in the synaptic gap and play antidepressive roles by effecting on 5-HTRs in postsynaptic membrane, 343 , 344 which also activate the cAMP-PKA pathway. 49 , 501 Moreover, TCAs and SNRIs can also inhibit the reuptake of NE by NETs, which also increase the concentration of NE in the synaptic gap, and in turn activate the effect of NE on adrenoceptors (ADRs) and activate the cAMP-PKA pathway in postsynaptic membrane. 502 Besides of the AC/cAMP/PKA pathway, the effect of NE on ADRs can also activate protein kinase B (Akt) phosphorylation and mammalian target of rapamycin complex 1 (mTORC1) by stimulating TrkB, in order to promote the secretion of postsynaptic density 95 (PSD95) and glutamate receptor 1 (GluR1). 502 Ketamine works as the antagonist of NMDAR on GABAergic interneurons, it suppresses the excitation of subsets of GABAergic interneurons, which reduces the gamma aminobutyric acid (GABA) effects on gamma aminobutyric acid type B receptor (GABABR), and relieves the inhibition of GABAergic interneurons on the release of glutamate, the latter further stimulates AMPAR on postsynaptic membrane and increases the level of BDNF, even the release of BDNF stimulates the above TrkB/AKT/mTORC1 pathway. 503 , 504 Adobe Illustrator was used to generate this figure

Novel therapeutic strategies

New animal models.

Establishing animal models with pathological features representative of those seen in humans is key for advancing MDD research. Currently, the widely utilized animal models of MDD include CUMS, behavioral despair (BD), learned helplessness (LH), and CSDS, drug withdrawal, and transgenic animal models. 395 The CUMS model, one of the most commonly used animal models for MDD, 64 , 172 exhibits depressive-like behaviors. 396 , 397 According to a meta-analysis of 408 papers involving stress protocols, the most commonly used stressors for CUMS models are food and water deprivation, light cycle modification, wet bedding, cage tilting, social stress, and forced swimming. 398 Recently, we constructed an improved depression model named the chronic unpredictable mild restraint (CUMR) model by using environmental interference. 62 The stressors used to construct this CUMR mouse model included activity restriction, damp bedding, cage shaking, tail suspension, forced swimming, and 45° cage tilting. These stressors all restrict the activity of the mice; moreover, stressors that disturb physiological rhythms, chronic unpredictable rhythm disturbance (CURD), can cause manic-like behaviors in mice (Fig. 7 ). The disease-related pathological changes and serum indicators in the CUMR and CURD models are highly similar to those in patients in the clinic, and therapeutic medicines can effectively improve brain function and behavior in these models. 62

The protocol and stressors used for CURD and CUMR. In order to establish the CUMR model, a combination of various stressors includes interference of constraint ( a ), damp bedding ( b ), cage shaking ( c ), tail suspension ( d ), forced swimming ( e ), and cage tilting ( f ). Among these six stressors, two were randomly selected and administered daily for a duration of 3 weeks. On the other hand, to establish the CUMR model, a set of behavioral constraints includes circadian rhythm ( g ), sleep deprivation ( h ), interference of cone light ( i ), interference of followed spotlight ( j ), high temperature stress ( k ), stroboscopic illumination ( l ), noise disturbance ( m ), and foot shock ( n ). Similarly, two out of these eight constraints were randomly chosen and applied daily for a period of 3 weeks 62

Phototherapy

Phototherapy plays a significant role in regulating emotional behavior 399 and can have strong and rapid effects on mood and alertness. 400 , 401 , 402 There is increasing evidence for the therapeutic efficacy of phototherapy for MDD. 403 , 404 The combination of phototherapy and antidepressants has better effects than antidepressants alone. 402 , 405 Phototherapy utilizes bright light with a specific wavelength to stimulate the retina and affect the production of 5-HT and hormones in the brain. 406 Furthermore, phototherapy can alleviate depressive-like behavior by targeting the retinal-thalamic ventral lateral geniculate nucleus/intergeniculate leaflet-lateral habenula (retinal-vlGN/IGL-LHb) circuit; this mechanism may explain how phototherapy alleviates MDD. 407

Repetitive transcranial magnetic stimulation

Repetitive transcranial magnetic stimulation (rTMS) is an effective method used in clinical practice for treating patients with MDD. 408 Multiple evaluations and analyses have shown that rTMS can effectively treat MDD in patients from different age groups, including children and adolescents, 409 , 410 adults, 411 , 412 and elderly patients. 413 , 414 It is suggested that early use of rTMS in the treatment of depression in elderly patients may yield better results. 415 Furthermore, research has indicated that rTMS can effectively treat perinatal depression. 416 Increasing evidence suggests that rTMS of the anterior stimulation site of the left dlPFC can yield optimal treatment outcomes. 417 , 418 , 419 A randomized controlled trial demonstrated that the efficacy of rTMS in treating depression is linked to precise targeting of the dlPFC, the activity of which exhibits a negative correlation with subgenual cingulate cortex activity. 420 Identifying the optimal site for stimulation may further enhance the ability of rTMS to treat depression. 421 Recently, a retrospective study was conducted, which included 29 systematic evaluations and reanalyzed 15 meta-analyses to assess the effectiveness and safety of transcranial magnetic stimulation (TMS) for treating MDD in adults. 422 The results of the study indicated significant variations in the efficacy of TMS for MDD across different settings and revealed poor tolerability in certain populations, the further research is necessary to identify specific beneficiary populations for TMS in treating MDD and to personalize treatment based on comprehensive and detailed information. 422

Psychological intervention

MDD is characterized by a gradual onset and a high risk of relapse. 421 The American Medical Association recommends psychological interventions for individuals who are at a high risk of MDD. Some of the interventions commonly used for depression treatment include acceptance and commitment therapy, cognitive therapy, cognitive behavioral therapy (CBT), interpersonal therapy, and psychodynamic therapies. 423 Specifically, the combination of psychological interventions and antidepressants effectively decreases the risk of relapse in cases of MDD. 424 , 425 , 426

Acupuncture

Acupuncture, which mainly includes traditional body needling, moxibustion, EA, and laser acupuncture, is a traditional Chinese treatment modality used to treat various diseases. 427 Compared with pharmacological therapies, acupuncture is more cost-effective and has fewer side effects. 428 EA stimulation can effectively treat MDD; 429 , 430 , 431 however, the specific mechanism by which acupuncture treats depression remains unclear. In previous research, EA at the ST36 acupoint was shown to prevent shrinkage of the prefrontal cortical astrocytes and alleviate depressive-like behavior in mice exposed to CUMS. 432 The results of an 8-week clinical study involving 46 female patients with severe depression suggested that acupuncture may achieve therapeutic effects by modulating the corticostriatal reward/motivation circuit in patients with severe depression. 433 Additionally, studies indicate that EA may have the potential to promote neuronal regeneration and exert antidepressant effects by elevating the phosphorylation of cyclic adenosine monophosphate response element binding protein and the levels of BDNF. 434 Acupuncture at the GV20 and GV24 acupoints may alleviate depression symptoms by regulating the calmodulin-dependent protein kinase (CaMK) signaling pathway. 435 The antidepressant effect of EA may also be associated with increased synaptic transmission in the ventromedial prefrontal cortex (vmPFC). 436 A recent meta-analysis of 43 randomized controlled trials involving adult subjects with acupuncture for MDD demonstrated that acupuncture, either alone or in combination with antidepressants, significantly reduced the hamilton depression scal scores and had fewer adverse effects compared to antidepressants, however, further rigorous experiments are still required to determine the optimal frequency of acupuncture for MDD in order to achieve better efficacy. 437

In conclusion, the common antidepressants can improve some depressive symptoms in some patients with depression, but are always associated with the risk of adverse effects or recurrence. Although some new developed treatment methods can improve depression symptoms in a certain program, the compatibility between potential treatment mechanisms and pathological mechanisms still needs further research. In particular, the therapeutic principle of acupuncture still needs to be explored in depth, and the accompanied therapeutic mechanism and application potential of traditional Chinese medicine in depression deserve to be explored in depth.

Clinical research progress

In summary, the pathological features of MDD and pharmacological mechanism of antidepressants have been widely studied. Furthermore, there have been many clinical studies on MDD, and studies of human postmortem tissues and clinical medical images, multomics studies, and preclinical/clinical trials of new therapeutic drugs have improved our understanding of the disease mechanism.

Transcriptional studies of human postmortem tissue

A recent meta-analysis of eight transcriptome datasets identified 566 disease-related genes that are consistently up- or downregulated in patients with MDD. The brain regions in which these genes are expressed include the amygdala, subgenual anterior cingulate, and dorsolateral prefrontal cortex, and the associated molecular pathways include reduced neurotrophic support, neural signaling, and GABA function. 438 Through the discovery of nonoverlapping proteins that bind to calcium parvalbumin, calretinin, and the neural peptide somatostatin, subgroups of GABA interneurons that govern main pyramidal neurons differently were identified. 439 Decreased cortical levels of GABA and specific populations of GABA neurons have been reported in investigations of postmortem MDD patient tissues, 440 and the SST mRNA level is specifically decreased in patients with MDD. 213

The DR nucleus is the largest and most significant conduit of forebrain serotonergic input. 441 In postmortem samples of the human brain, several transcriptional regulators are dysregulated within the DR, including transcription-related elements (such as EGR1, TOB1, and CSDA), which bind to genes to stimulate their expression directly or in response to environmental cues, and NRs (NR4A2, NR4A3, THRA, and THRB), which are activated by ligands and regulate translation by targeting genes. 442 In addition, transporters for GRs generally regulate the activity of the HPA axis by negative feedback. 443 According to studies of postmortem brain tissues, hyperactivity of the HPA axis in MDD patients could be caused by methylation-mediated changes in GR transcription. 444 The expression of nerve growth factor-inducible protein A (NGFI-A), an enzyme that bindss exon 1 F of GR, is reduced in the hippocampus of patients with MDD, which may contribute to low methylation levels in the brain. 444 Moreover, in postmortem MDD patients, total GR levels are unchanged, while level of GRα in the amygdala and cingulate gyrus is decreased.

Sex-related molecular markers of MDD

Women are more likely than males to experience recurring MDD 445 and are twice as likely to experience MDD throughout their lifetimes. 446 Compared with male patients, female patients with MDD have symptoms that manifest sooner in the disease course, last longer, and are more severe; in addition, they experience hunger changes, weight fluctuations, and sleep difficulties more frequently. 447 , 448

In postmortem samples of patients who committed suicide due to MDD, the expression of DNA methyltransferases (DNMTs) in the frontopolar cortex was found to be more significantly increased in women than in men; elevated methylation is associated with decreased levels of the GABA A receptor alpha-1 subunit in men, which supports sex-related epigenetic alterations in transcription. 449 A gene array meta-analysis also revealed sex differences in MDD, with depressed females being more likely than depressed men to have lower production of somatostatin, a GABA neuron biomarker in corticolimbic brain regions according to postmortem analysis. 450 X-linked chromosomal polymorphisms affect the expression of the GABA-synthesizing enzyme and somatostatin. 450 Analyses of postmortem brain tissues showed an increase in the transcription of numerous glutamate-related genes in the prefrontal cortex in depressed women but not in depressed men; depressed women exhibited more alterations in glutamate receptor expression, while depressed men showed only GRM5 downregulation. 451

In postmortem brain specimens, there were no transcription differences between MDD men and controls, and the levels of 5-HT 1D receptors and the transcription factors NUDR and REST, which regulate 5-HT activity, in 5-HT-containing neurons in the ventral raphe nuclei were found to be higher in MDD females. 452 5-HT receptors and regulators were shown to exhibit sex-specific alterations in expression at the protein level, and postmortem investigations have largely focused on female subjects. The protein levels of 5-HT 1A R and NUDR, which regulate 5-HT signaling, in the prefrontal cortex were found to be lower in MDD women than in control subjects; however, this difference was not observed in MDD males compared with controls. 453 The NA/NE system, especially in the LC, is another monoaminergic system that exhibits sex-related variations and influences MDD risk. In fact, some researchers have found that the levels of microRNAs (miRNAs), short RNA molecules that control the expression of genes and play roles in psychological disorders, 454 are higher in the LC of suicidal female subjects than in the LC of suicidal male subjects. MiR-1179 is associated with GRIA3 and MAOA, which are involved in neuropsychiatric diseases. 455

OS is commonly linked to the onset of MDD. A study found that whereas cysteine and 1-methylinosine levels were much higher in males with MDD, they were significantly lower in females with MDD. 456 These metabolites are related to OS. Furthermore, several studies found a significant link between MDD and lipid metabolism; 457 for example, as 1-Oalkyl-2-acyl-PEs levels are decreased in MDD, showing a negative correlation with the extent of depression, lysophospholipid (LPC) and phospholipid (PC) levels are increased in MDD, exhibiting a substantial positive correlation with depression severity. 458 Similarly, a study found that men and women had different lipid concentrations. 456 These clinical data suggest that sex differences in MDD may result from differences in OS and lipid metabolism, but further research is required to make this connection.

Multiomics studies

Transcriptome studies, which explore relationships among the expression of genes and diseases, are regarded as an essential for investigating disease-causing mutations in genes, the mechanisms of disease development and progression, and disease-related target genes. 459 Dorsolateral prefrontal cortex tissues have been employed to identify genes and miRNAs that show changes in expression and biological processes that are altered in patients with MDD. 460 Serpin Family H Member 1 (SERPINH1), IL-8, humanin like-8 (MTRNRL8), and chemokine ligand 4 (CCL4) are among the genes whose expression is altered in MDD. 460 , 461 According to Gene Ontology (GO) enrichment analysis, MDD is related to decreased expression of genes related to oligodendrocyte development, glutamatergic neurotransmission modulation, and oxytocin receptor expression. These findings confirm that impairment of the blood-brain barrier and microglial, endothelial cell, ATPase, and astrocyte function exacerbate MDD; the involvement of these cells, molecules, and structures in MDD should be further investigated. 460

The field of study known as genomics focuses on the transcription of genes, the precise interactions among genes, and the control of gene activity. MDD has been linked to numerous biological processes, including energy metabolism. When the transcription of genes involved in glycolysis and glycogen synthesis was examined in the hippocampus of depressed rats, it was found that the mRNA expression of Slc2a3, which codes for GLUT3, is considerably increased. 462 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase B (LDHB) mRNA levels were found to be substantially decreased in MDD. 462 The transcription of genes in the brain tissues of IL18 - / - mice was examined with the use of genome-wide microarrays, and the results revealed that urocortin 3 (Ucn3) expression was increased. 463 Ucn3 controls how the body processes glucose; 464 therefore, a change in Ucn3 expression will result in energy imbalance. Gene comethylation analysis was performed in the brains of individuals with MDD. The findings revealed that the methylation of genes associated with mitochondria was dramatically decreased, indicating impaired mitochondrial function. 465

Metabolomics has recently emerged as a useful technique for identifying markers and pathways associated with a wide range of diseases. 466 It is often used to analyze the mechanisms underlying disease occurrence and progression and the effects of small-molecule compounds. In one study, targeted metabolomic analysis of the CSF of 14 MDD patients who were not taking medication, 14 MDD patients in remission, and 18 healthy controls was performed. 467 An analysis of the tryptophan, tyrosine, purine pathways, and associated pathways revealed that in patients in remission, methionine levels were higher, while tryptophan and tyrosine levels were lower. The same group of patients also showed changes in the methionine-to-glutathione ratio, indicating alterations in OS and methylation. The levels of these same metabolites were altered in MDD patients who were not taking medication, although not to a significant degree. 467

Clinical medical imaging studies

MRI has been widely employed in research in recent years to pinpoint patterns of brain alterations linked to MDD. Many studies have demonstrated that structural and fMRI has outstanding potential as trustworthy imaging modalities for monitoring MDD treatment responses. A study indicated that MDD patients had large volume decreases in various frontal areas, such as the anterior cingulate cortex and OFC, which were linked to problems with stress management and emotional processing. 468 People with MDD also exhibited structural changes in their parietal lobes. 469 Alterations in the total gray matter volume and an increase in cortical thickness are the two findings that are most consistent. 470

The functional changes in the frontal lobe in MDD are hotly contested. A study discovered lower precuneus, supragenual anterior cingulate cortex, dorsomedial PFC, and dorsomedial thalamus lower activity when processing pleasant stimuli in MDD patients. 471 Another study found that during the processing of favorable self-indulgent information, individuals with MDD displayed higher activity in the medial PFC and anterior cingulate cortex. 472 The right hippocampus, parahippocampal gyrus, left amygdala, and the whole caudate nucleus all had functional changes in activity in MDD patients compared to healthy controls, indicating that the temporal lobe might be involved in the pathogenesis of MDD. 473

Although it is not feasible to evaluate synapse density directly in people in vivo, positron emission tomography (PET) can be utilized to gather useful information. It is thought that impairments of functional connections and synaptic atrophy are two factors that contribute to the symptoms of MDD. An indirect method of estimating synaptic density is to count the number of nerve terminals using synaptic vesicle glycoprotein 2 A (SV2A). The researchers examined synaptic density in MDD patients who were not taking any medication using positron emission PET with the SV2A radioligand [ 11 C] UCB-J. 474 The results revealed that reductions in the synapse density in areas connected with various processes, such as emotion control and thought (the dorsolateral prefrontal cortex, anterior cingulate cortex, and hippocampus), are related to to the severity of depressive disorders. Additionally, it was shown that compared with healthy subjects, subjects with MDD had reduced dlPFC resting-state connectivity throughout the brain. It was found that the dlPFC-posterior cingulate cortex connection was inversely negatively linked to the severity of depression symptoms and connected with synapse activity in the dlPFC, indicating that synaptic loss may impair antagonistism within the centers of both networks, which are typically at odds. 474

Preclinical and clinical trials of new therapeutic drugs

Esmethadone is a new, noncompetitive NMDAR antagonist 475 that exhibits fast antidepressant-like action by improving performance of rats in the forced swim test. 476 Esmethadone can also alleviate neural dysfunction linked to symptoms of depression by boosting the synapse and spine density and restoring spinogenesis, in addition to correcting depressive-like behaviors in animal models of depression. 378 , 477 Esmethadone was found to reduce cognitive symptoms in individuals with MDD in a stage II clinical study 478 and to increase the levels of circulating BDNF in normal individuals in a stage I clinical investigation. 479 In a phase II study involving patients who had received insufficient benefit from conventional antidepressants, esmethadone demonstrated immediate, strong, and long-lasting antidepressant benefits. 478

Ketamine is the most well-known rapid-acting antidepressant and an NMDAR antagonist. 383 GluN1, GluN2, and GluN3 are NMDAR subunits. 480 Ketamine exerts a quick and effective antidepressant effect by binding to the asparagine 616 residue of GluN1 and the leucine 642 residue of GluN2A. 192 In a clinical experiment, the effect of supplementary injection of subanesthetic doses of ketamine on thoughts of suicide in MDD patients was evaluated, and the results showed that the reduction in thoughts of suicide among MDD patients receiving ketamine was mostly sustained. 481 In several studies, a single dose of ketamine reduced immobility in the forced swim test immediately after injection and had effects similar to those of an antidepressant. 482 , 483

The S-enantiomer of ketamine, esketamine, has been approved by the U.S. Food and Drug Administration (FDA) for depression treatment. 383 Moreover, formulations of ketamine are also being developed, and intranasal esketamine spray has shown high efficacy in treating MDD. 484 Additionally, hydroxynorketamine (HNK), a metabolite of ketamine, can exert its anti-depressive effects by an NMDAR-independent mechanism. 377 One of these mechanisms involves increasing BDNF levels; an increasing number of studies have shown that BDNF signaling is an important target of antidepressants. 377 Thus, ketamine can also exert anti-inflammatory effects, a large amount of evidence suggests a tight relationship between neuroinflammation and the pathogenesis of MDD. 485 , 486 , 487 A summary of clinical trials related to new therapeutic drugs for MDD is shown in Table 1 .

The development of the present therapeutic medicines in clinic mainly targets the discovered pharmacological targets, mainly focusing on the key receptors or enzymes. However, at the organelle level of neural cells, the disturbed energy metabolism of mitochondria and the related RNA drugs, as well as the dysfunctions of lipid and glucose metabolism in psychopathological condition, still need deep exploration. Totally, the research on the mechanism of therapeutic drugs always requires the development of pathological mechanisms as support.

Conclusions and future perspectives

MDD is a heterogeneous disease, its pathological and pharmacological mechanisms are still unclear, and diagnostic and therapeutic methods for MDD are limited. SSRIs and SNRIs are the first-line treatments for MDD in the clinic; however, a sizable portion of MDD patients do not respond well to the currently available antidepressants. According to research on real-world sequential therapies, even after numerous treatment attempts, almost 30% of MDD patients do not experience remission. This suggests that the existing theories and hypotheses cannot completely explain the pathogenesis of MDD and that more research on the pharmacological mechanisms of currently available antidepressants is still needed. We mainly discussed the potential etiology and pathogenesis of MDD from the perspective of widely accepted theories, including the neurotransmitter and receptor hypothesis, HPA axis hypothesis, cytokine hypothesis, neuroplasticity hypothesis and systemic influence hypothesis. A more comprehensive understanding of the pathophysiological mechanisms of MDD might significantly improve our capacity to develop preventive and more effective therapeutic methods that can help reduce the burden of and pain caused by major depression. Knowledge of the cellular processes that drive these alterations and the symptoms they cause may offer crucial will provide insight for new treatments.

MDD is connected with several cellular and structural modifications in the nervous system. Nonetheless, in the majority of these alterations cannot be consistently observed in vivo. Therefore, several issues need to be considered in future research: (i) Studies of animal models have made important contributions to our understanding of the pathophysiology of major depression, and more representative animal models of MDD should be developed. (ii) Because of our incomplete understanding of the disease and the disease’s intrinsic intricacy, there is an urgent need to develop updated imaging technologies and imaging software to allow advances in our understanding of the disease. (iii) The therapeutic shortcomings of traditional antidepressants have prompted the need for further drug discovery and development. (iv) MDD is strongly associated with many systems, and it will be important to further elucidate the mechanisms associated with MDD and other pathological conditions.

Disease, G. B. D., Injury, I. & Prevalence, C. Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases and injuries for 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet 392 , 1789–1858 (2018).

Article   Google Scholar  

Nagy, C. et al. Single-nucleus transcriptomics of the prefrontal cortex in major depressive disorder implicates oligodendrocyte precursor cells and excitatory neurons. Nat. Neurosci. 23 , 771–781 (2020).

Article   CAS   PubMed   Google Scholar  

Malhi, G. S. & Mann, J. J. Depression Lancet 392 , 2299–2312 (2018).

Article   PubMed   Google Scholar  

Fellinger, M. et al. Seasonality in major depressive disorder: effect of sex and age. J. Affect Disord. 296 , 111–116 (2022).

Liu, C. H. et al. Role of inflammation in depression relapse. J. Neuroinflammation 16 , 90 (2019).

Article   PubMed   PubMed Central   Google Scholar  

Burcusa, S. L. & Iacono, W. G. Risk for recurrence in depression. Clin. Psychol. Rev. 27 , 959–985 (2007).

Monroe, S. M. & Harkness, K. L. Life stress, the “kindling” hypothesis, and the recurrence of depression: considerations from a life stress perspective. Psychol. Rev. 112 , 417–445 (2005).

Albert, K. M. & Newhouse, P. A. Estrogen, stress, and depression: cognitive and biological interactions. Annu. Rev. Clin. Psychol. 15 , 399–423 (2019).

Kessler, R. C., Chiu, W. T., Demler, O., Merikangas, K. R. & Walters, E. E. Prevalence, severity, and comorbidity of 12-month DSM-IV disorders in the National Comorbidity Survey Replication. Arch. Gen. Psychiatry 62 , 617–627 (2005).

Monteleone, P. & Maj, M. The circadian basis of mood disorders: recent developments and treatment implications. Eur. Neuropsychopharmacol. 18 , 701–711 (2008).

Rice, F. et al. Adolescent and adult differences in major depression symptom profiles. J. Affect Disord. 243 , 175–181 (2019).

Hasin, D. S. et al. Epidemiology of adult DSM-5 major depressive disorder and its specifiers in the United States. JAMA Psychiatry 75 , 336–346 (2018).

Howard, D. M. et al. Genome-wide association study of depression phenotypes in UK Biobank identifies variants in excitatory synaptic pathways. Nat. Commun. 9 , 1470 (2018).

Kovacs, M. & Lopez-Duran, N. Prodromal symptoms and atypical affectivity as predictors of major depression in juveniles: implications for prevention. J. Child Psychol. Psychiatry 51 , 472–496 (2010).

Stetler, C. & Miller, G. E. Depression and hypothalamic-pituitary-adrenal activation: a quantitative summary of four decades of research. Psychosom. Med. 73 , 114–126 (2011).

Milaneschi, Y., Lamers, F., Berk, M. & Penninx, B. Depression heterogeneity and its biological underpinnings: toward immunometabolic depression. Biol. Psychiatry 88 , 369–380 (2020).

Zhou, X. et al. Astrocyte, a promising target for mood disorder interventions. Front. Mol. Neurosci. 12 , 136 (2019).

Article   CAS   PubMed   PubMed Central   Google Scholar  

Monroe, S. M. & Harkness, K. L. Major depression and its recurrences: life course matters. Annu. Rev. Clin. Psychol. 18 , 329–357 (2022).

Wray, N. R. et al. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression. Nat. Genet. 50 , 668–681 (2018).

Gittins, R. A. & Harrison, P. J. A morphometric study of glia and neurons in the anterior cingulate cortex in mood disorder. J. Affect. Disord. 133 , 328–332 (2011).

Miguel-Hidalgo, J. J. et al. Glial and glutamatergic markers in depression, alcoholism, and their comorbidity. J. Affect. Disord. 127 , 230–240 (2010).

Sequeira, A. et al. Global brain gene expression analysis links glutamatergic and GABAergic alterations to suicide and major depression. PLoS ONE 4 , e6585 (2009).

Rajkowska, G. & Stockmeier, C. A. Astrocyte pathology in major depressive disorder: insights from human postmortem brain tissue. Curr. Drug Targets 14 , 1225–1236 (2013).

Tsuang, M. T., Taylor, L. & Faraone, S. V. An overview of the genetics of psychotic mood disorders. J. Psychiatr. Res 38 , 3–15 (2004).

Lohoff, F. W. Overview of the genetics of major depressive disorder. Curr. Psychiatry Rep. 12 , 539–546 (2010).

Kendall, K. M. et al. The genetic basis of major depression. Psychol. Med. 51 , 2217–2230 (2021).

Power, R. A. et al. Genome-wide association for major depression through age at onset stratification: Major Depressive Disorder Working Group of the psychiatric genomics consortium. Biol. Psychiatry 81 , 325–335 (2017).

Huang, C. et al. Proteomic analysis of olfactory bulb suggests CACNA1E as a promoter of CREB signaling in microbiota-induced depression. J. Proteom. 194 , 132–147 (2019).

Article   CAS   Google Scholar  

Flint, J. The genetic basis of major depressive disorder. Mol. Psychiatry 28 , 2254–2265 (2023).

Tripp, A., Kota, R. S., Lewis, D. A. & Sibille, E. Reduced somatostatin in subgenual anterior cingulate cortex in major depression. Neurobiol. Dis. 42 , 116–124 (2011).

Seney, M. L., Tripp, A., McCune, S., Lewis, D. A. & Sibille, E. Laminar and cellular analyses of reduced somatostatin gene expression in the subgenual anterior cingulate cortex in major depression. Neurobiol. Dis. 73 , 213–219 (2015).

Hicks, E. M. et al. Integrating genetics and transcriptomics to study major depressive disorder: a conceptual framework, bioinformatic approaches, and recent findings. Transl. Psychiatry 13 , 129 (2023).

Labonte, B. et al. Sex-specific transcriptional signatures in human depression. Nat. Med. 23 , 1102–1111 (2017).

Levey, D. F. et al. Bi-ancestral depression GWAS in the Million Veteran Program and meta-analysis in >1.2 million individuals highlight new therapeutic directions. Nat. Neurosci. 24 , 954–963 (2021).

Cohen-Woods, S., Craig, I. W. & McGuffin, P. The current state of play on the molecular genetics of depression. Psychol. Med. 43 , 673–687 (2013).

Slavich, G. M. & Sacher, J. Stress, sex hormones, inflammation, and major depressive disorder: Extending Social Signal Transduction Theory of Depression to account for sex differences in mood disorders. Psychopharmacology 236 , 3063–3079 (2019).

McEwen, B. S., Nasca, C. & Gray, J. D. Stress effects on neuronal structure: hippocampus, amygdala, and prefrontal cortex. Neuropsychopharmacology 41 , 3–23 (2016).

Fries, G. R., Saldana, V. A., Finnstein, J. & Rein, T. Molecular pathways of major depressive disorder converge on the synapse. Mol. Psychiatry 28 , 284–297 (2023).

Keller, J. et al. HPA axis in major depression: cortisol, clinical symptomatology and genetic variation predict cognition. Mol. Psychiatry 22 , 527–536 (2017).

Dong, L., Li, B., Verkhratsky, A. & Peng, L. Cell type-specific in vivo expression of genes encoding signalling molecules in the brain in response to chronic mild stress and chronic treatment with fluoxetine. Psychopharmacology 232 , 2827–2835 (2015).

Xia, M. et al. Sleep deprivation selectively down-regulates astrocytic 5-HT(2B) receptors and triggers depressive-like behaviors via stimulating P2X(7) receptors in mice. Neurosci. Bull. 36 , 1259–1270 (2020).

Hare, D. L., Toukhsati, S. R., Johansson, P. & Jaarsma, T. Depression and cardiovascular disease: a clinical review. Eur. Heart J. 35 , 1365–1372 (2014).

Dunbar, J. A. et al. Depression: an important comorbidity with metabolic syndrome in a general population. Diabetes Care 31 , 2368–2373 (2008).

Arnaud, A. M. et al. Impact of major depressive disorder on comorbidities: a systematic literature review. J. Clin. Psychiatry 83 , 21r14328 (2022).

Sato, S. & Yeh, T. L. Challenges in treating patients with major depressive disorder: the impact of biological and social factors. CNS Drugs 27 , S5–10 (2013).

Greenberg, P. E., Fournier, A. A., Sisitsky, T., Pike, C. T. & Kessler, R. C. The economic burden of adults with major depressive disorder in the United States (2005 and 2010). J. Clin. Psychiatry 76 , 155–162 (2015).

Greenberg, P. E. et al. The economic burden of adults with major depressive disorder in the United States (2010 and 2018). Pharmacoeconomics 39 , 653–665 (2021).

Dean, J. & Keshavan, M. The neurobiology of depression: an integrated view. Asian J. Psychiatr. 27 , 101–111 (2017).

Bhatt, S., Devadoss, T., Manjula, S. N. & Rajangam, J. 5-HT(3) receptor antagonism a potential therapeutic approach for the treatment of depression and other disorders. Curr. Neuropharmacol. 19 , 1545–1559 (2021).

Inazu, M., Takeda, H. & Matsumiya, T. Functional expression of the norepinephrine transporter in cultured rat astrocytes. J. Neurochem. 84 , 136–144 (2003).

Schipke, C. G., Heuser, I. & Peters, O. Antidepressants act on glial cells: SSRIs and serotonin elicit astrocyte calcium signaling in the mouse prefrontal cortex. J. Psychiatr. Res. 45 , 242–248 (2011).

Novikova, I. N. et al. Adrenaline induces calcium signal in astrocytes and vasoconstriction via activation of monoamine oxidase. Free Radic. Biol. Med. 159 , 15–22 (2020).

Martin, H. et al. Insulin modulates emotional behavior through a serotonin-dependent mechanism. Mol. Psychiatry (2022). [Oline ahead of print].

Ogawa, S. et al. Plasma L-tryptophan concentration in major depressive disorder: new data and meta-analysis. J. Clin. Psychiatry 75 , e906–915 (2014).

Fang, Y. et al. Fluoxetine inhibited the activation of A1 reactive astrocyte in a mouse model of major depressive disorder through astrocytic 5-HT(2B)R/beta-arrestin2 pathway. J. Neuroinflammation 19 , 23 (2022).

Savitz, J., Lucki, I. & Drevets, W. C. 5-HT(1A) receptor function in major depressive disorder. Prog. Neurobiol. 88 , 17–31 (2009).

Verkhratsky, A., Rodriguez, J. J. & Parpura, V. Astroglia in neurological diseases. Future Neurol. 8 , 149–158 (2013).

Zhang, S. et al. 5-HT2B receptors are expressed on astrocytes from brain and in culture and are a chronic target for all five conventional ‘serotonin-specific reuptake inhibitors. Neuron Glia Biol. 6 , 113–125 (2010).

Verkhratsky, A., Parpura, V., Scuderi, C. & Li, B. Astroglial serotonin receptors as the central target of classic antidepressants. Adv. Neurobiol. 26 , 317–347 (2021).

Li, B. et al. Biphasic regulation of caveolin-1 gene expression by fluoxetine in astrocytes: opposite effects of PI3K/AKT and MAPK/ERK signaling pathways on c-fos. Front. Cell. Neurosci. 11 , 335 (2017).

Li, B., Zhang, S., Li, M., Hertz, L. & Peng, L. Chronic treatment of astrocytes with therapeutically relevant fluoxetine concentrations enhances cPLA2 expression secondary to 5-HT 2B -induced, transactivation-mediated ERK 1/2 phosphorylation. Psychopharmacology 207 , 1–12 (2009).

Li, X. et al. A novel murine model of mania. Mol. Psychiatry 28 , 3044–3054 (2023).

Li, B., Zhang, S., Zhang, H., Hertz, L. & Peng, L. Fluoxetine affects GluK2 editing, glutamate-evoked Ca(2+) influx and extracellular signal-regulated kinase phosphorylation in mouse astrocytes. J. Psychiatry Neurosci. 36 , 322–338 (2011).

Li, B. et al. Cell type-specific gene expression and editing responses to chronic fluoxetine treatment in the in vivo mouse brain and their relevance for stress-induced anhedonia. Neurochem. Res. 37 , 2480–2495 (2012).

Breton-Provencher, V., Drummond, G. T., Feng, J., Li, Y. & Sur, M. Spatiotemporal dynamics of noradrenaline during learned behaviour. Nature 606 , 732–738 (2022).

Mori, K. et al. Effects of norepinephrine on rat cultured microglial cells that express alpha1, alpha2, beta1 and beta2 adrenergic receptors. Neuropharmacology 43 , 1026–1034 (2002).

O’Sullivan, J. B., Ryan, K. M., Curtin, N. M., Harkin, A. & Connor, T. J. Noradrenaline reuptake inhibitors limit neuroinflammation in rat cortex following a systemic inflammatory challenge: implications for depression and neurodegeneration. Int. J. Neuropsychopharmacol. 12 , 687–699 (2009).

Choi, H. S. et al. The anti-inflammatory activity of duloxetine, a serotonin/norepinephrine reuptake inhibitor, prevents kainic acid-induced hippocampal neuronal death in mice. J. Neurol. Sci. 358 , 390–397 (2015).

Wang, J. et al. Desvenlafaxine prevents white matter injury and improves the decreased phosphorylation of the rate-limiting enzyme of cholesterol synthesis in a chronic mouse model of depression. J. Neurochem. 131 , 229–238 (2014).

Luo, Y., Kataoka, Y., Ostinelli, E. G., Cipriani, A. & Furukawa, T. A. National prescription patterns of antidepressants in the treatment of adults with major depression in the US Between 1996 and 2015: a population representative survey based analysis. Front. Psychiatry 11 , 35 (2020).

Sun, J. D., Liu, Y., Yuan, Y. H., Li, J. & Chen, N. H. Gap junction dysfunction in the prefrontal cortex induces depressive-like behaviors in rats. Neuropsychopharmacology 37 , 1305–1320 (2012).

Zepeda, R. et al. Venlafaxine treatment after endothelin-1-induced cortical stroke modulates growth factor expression and reduces tissue damage in rats. Neuropharmacology 107 , 131–145 (2016).

Bekhbat, M. et al. Correction to: functional connectivity in reward circuitry and symptoms of anhedonia as therapeutic targets in depression with high inflammation: evidence from a dopamine challenge study. Mol. Psychiatry 27 , 4122 (2022).

Cui, Y. et al. Astroglial Kir4.1 in the lateral habenula drives neuronal bursts in depression. Nature 554 , 323–327 (2018).

Skupio, U. et al. Astrocytes determine conditioned response to morphine via glucocorticoid receptor-dependent regulation of lactate release. Neuropsychopharmacology 45 , 404–415 (2020).

Rasheed, N. et al. Differential response of central dopaminergic system in acute and chronic unpredictable stress models in rats. Neurochem. Res. 35 , 22–32 (2010).

Morales, I., Fuentes, A., Ballaz, S., Obeso, J. A. & Rodriguez, M. Striatal interaction among dopamine, glutamate and ascorbate. Neuropharmacology 63 , 1308–1314 (2012).

Solis, O., Garcia-Sanz, P., Herranz, A. S., Asensio, M. J. & Moratalla, R. L-DOPA reverses the increased free amino acids tissue levels induced by dopamine depletion and rises GABA and tyrosine in the striatum. Neurotox. Res. 30 , 67–75 (2016).

Corkrum, M. et al. Dopamine-evoked synaptic regulation in the nucleus accumbens requires astrocyte activity. Neuron 105 , 1036–1047.e1035 (2020).

Adermark, L. et al. Astrocytes modulate extracellular neurotransmitter levels and excitatory neurotransmission in dorsolateral striatum via dopamine D2 receptor signaling. Neuropsychopharmacology 47 , 1493–1502 (2022).

Agren, R. & Sahlholm, K. Voltage-dependent dopamine potency at D(1)-like dopamine receptors. Front Pharmacol. 11 , 581151 (2020).

Fasano, C. et al. Dopamine facilitates dendritic spine formation by cultured striatal medium spiny neurons through both D1 and D2 dopamine receptors. Neuropharmacology 67 , 432–443 (2013).

Hao, Y. & Plested, A. J. R. Seeing glutamate at central synapses. J. Neurosci. Methods 375 , 109531 (2022).

Trudler, D. et al. alpha-synuclein oligomers induce glutamate release from astrocytes and excessive extrasynaptic NMDAR activity in neurons, thus contributing to synapse loss. J. Neurosci. 41 , 2264–2273 (2021).

Schmitz, F. et al. Methylphenidate decreases ATP levels and impairs glutamate uptake and Na(+),K(+)-ATPase activity in juvenile rat hippocampus. Mol. Neurobiol. 54 , 7796–7807 (2017).

Kucukibrahimoglu, E. et al. The change in plasma GABA, glutamine and glutamate levels in fluoxetine- or S-citalopram-treated female patients with major depression. Eur. J. Clin. Pharmacol. 65 , 571–577 (2009).

Chiba, S. et al. Chronic restraint stress causes anxiety- and depression-like behaviors, downregulates glucocorticoid receptor expression, and attenuates glutamate release induced by brain-derived neurotrophic factor in the prefrontal cortex. Prog. Neuropsychopharmacol. Biol. Psychiatry 39 , 112–119 (2012).

Sullivan, R. et al. Cloning, transport properties, and differential localization of two splice variants of GLT-1 in the rat CNS: implications for CNS glutamate homeostasis. Glia 45 , 155–169 (2004).

Zou, J. et al. Glutamine synthetase down-regulation reduces astrocyte protection against glutamate excitotoxicity to neurons. Neurochem. Int. 56 , 577–584 (2010).

Karlsson, R. M. et al. Assessment of glutamate transporter GLAST (EAAT1)-deficient mice for phenotypes relevant to the negative and executive/cognitive symptoms of schizophrenia. Neuropsychopharmacology 34 , 1578–1589 (2009).

Karlsson, R. M. et al. Reduced alcohol intake and reward associated with impaired endocannabinoid signaling in mice with a deletion of the glutamate transporter GLAST. Neuropharmacology 63 , 181–189 (2012).

Di Castro, M. A. et al. Local Ca2+ detection and modulation of synaptic release by astrocytes. Nat. Neurosci. 14 , 1276–1284 (2011).

Matos, M. et al. Deletion of adenosine A2A receptors from astrocytes disrupts glutamate homeostasis leading to psychomotor and cognitive impairment: relevance to schizophrenia. Biol. Psychiatry 78 , 763–774 (2015).

Yue, N. et al. Activation of P2X7 receptor and NLRP3 inflammasome assembly in hippocampal glial cells mediates chronic stress-induced depressive-like behaviors. J. Neuroinflammation 14 , 102 (2017).

Cao, X. et al. Astrocyte-derived ATP modulates depressive-like behaviors. Nat. Med. 19 , 773–777 (2013).

Cunha, G. M., Canas, P. M., Oliveira, C. R. & Cunha, R. A. Increased density and synapto-protective effect of adenosine A2A receptors upon sub-chronic restraint stress. Neuroscience 141 , 1775–1781 (2006).

Batalha, V. L. et al. Adenosine A(2A) receptor blockade reverts hippocampal stress-induced deficits and restores corticosterone circadian oscillation. Mol. Psychiatry 18 , 320–331 (2013).

Wang, M. et al. Lateral septum adenosine A(2A) receptors control stress-induced depressive-like behaviors via signaling to the hypothalamus and habenula. Nat. Commun. 14 , 1880 (2023).

Lucas, M. et al. Coffee, caffeine, and risk of completed suicide: results from three prospective cohorts of American adults. World J. Biol. Psychiatry 15 , 377–386 (2014).

Lucas, M. et al. Coffee, caffeine, and risk of depression among women. Arch. Intern. Med. 171 , 1571–1578 (2011).

Coelho, J. E. et al. Overexpression of adenosine A2A receptors in rats: effects on depression, locomotion, and anxiety. Front. Psychiatry 5 , 67 (2014).

Kaster, M. P. et al. Caffeine acts through neuronal adenosine A2A receptors to prevent mood and memory dysfunction triggered by chronic stress. Proc. Natl Acad. Sci. USA 112 , 7833–7838 (2015).

Hines, D. J., Schmitt, L. I., Hines, R. M., Moss, S. J. & Haydon, P. G. Antidepressant effects of sleep deprivation require astrocyte-dependent adenosine mediated signaling. Transl. Psychiatry 3 , e212 (2013).

Etievant, A. et al. Astroglial control of the antidepressant-like effects of prefrontal cortex deep brain stimulation. EBioMedicine 2 , 898–908 (2015).

Serchov, T. et al. Increased signaling via adenosine A1 receptors, sleep deprivation, imipramine, and ketamine inhibit depressive-like behavior via induction of Homer1a. Neuron 87 , 549–562 (2015).

Dostal, C. R., Carson Sulzer, M., Kelley, K. W., Freund, G. G. & McCusker, R. H. Glial and tissue-specific regulation of Kynurenine Pathway dioxygenases by acute stress of mice. Neurobiol. Stress 7 , 1–15 (2017).

Yang, W. et al. Dex modulates the balance of water-electrolyte metabolism by depressing the expression of AVP in PVN. Front. Pharmacol. 13 , 919032 (2022).

Jacobson, L. Forebrain glucocorticoid receptor gene deletion attenuates behavioral changes and antidepressant responsiveness during chronic stress. Brain Res. 1583 , 109–121 (2014).

Perez, P. Glucocorticoid receptors, epidermal homeostasis and hair follicle differentiation. Dermatoendocrinol 3 , 166–174 (2011).

Reichrath, J. Ancient friends, revisited: new aspects on the important role of nuclear receptor signalling for skin physiology and for the treatment of skin diseases. Dermatoendocrinol 3 , 121–124 (2011).

Herbert, J. & Lucassen, P. J. Depression as a risk factor for Alzheimer’s disease: genes, steroids, cytokines and neurogenesis - What do we need to know? Front. Neuroendocrinol. 41 , 153–171 (2016).

Rosenthal, L. J., Goldner, W. S. & O’Reardon, J. P. T3 augmentation in major depressive disorder: safety considerations. Am. J. Psychiatry 168 , 1035–1040 (2011).

Mokrani, M. C., Duval, F., Erb, A., Gonzalez Lopera, F. & Danila, V. Are the thyroid and adrenal system alterations linked in depression? Psychoneuroendocrinology 122 , 104831 (2020).

Stenzel, D. & Huttner, W. B. Role of maternal thyroid hormones in the developing neocortex and during human evolution. Front. Neuroanat. 7 , 19 (2013).

Mendes-de-Aguiar, C. B. et al. Thyroid hormone increases astrocytic glutamate uptake and protects astrocytes and neurons against glutamate toxicity. J. Neurosci. Res. 86 , 3117–3125 (2008).

Rastogi, L., Godbole, M. M., Sinha, R. A. & Pradhan, S. Reverse triiodothyronine (rT3) attenuates ischemia-reperfusion injury. Biochem. Biophys. Res. Commun. 506 , 597–603 (2018).

Isgor, C. & Watson, S. J. Estrogen receptor alpha and beta mRNA expressions by proliferating and differentiating cells in the adult rat dentate gyrus and subventricular zone. Neuroscience 134 , 847–856 (2005).

Russell, J. K., Jones, C. K. & Newhouse, P. A. The role of estrogen in brain and cognitive aging. Neurotherapeutics 16 , 649–665 (2019).

Biegon, A., Reches, A., Snyder, L. & McEwen, B. S. Serotonergic and noradrenergic receptors in the rat brain: modulation by chronic exposure to ovarian hormones. Life Sci. 32 , 2015–2021 (1983).

Arinami, H., Suzuki, Y., Tajiri, M., Tsuneyama, N. & Someya, T. Role of insulin-like growth factor 1, sex and corticosteroid hormones in male major depressive disorder. BMC Psychiatry 21 , 157 (2021).

Walf, A. A., Rhodes, M. E. & Frye, C. A. Antidepressant effects of ERbeta-selective estrogen receptor modulators in the forced swim test. Pharm. Biochem Behav. 78 , 523–529 (2004).

Frye, C. A. & Walf, A. A. Estrogen and/or progesterone administered systemically or to the amygdala can have anxiety-, fear-, and pain-reducing effects in ovariectomized rats. Behav. Neurosci. 118 , 306–313 (2004).

Hughes, Z. A. et al. WAY-200070, a selective agonist of estrogen receptor beta as a potential novel anxiolytic/antidepressant agent. Neuropharmacology 54 , 1136–1142 (2008).

Weiser, M. J., Wu, T. J. & Handa, R. J. Estrogen receptor-beta agonist diarylpropionitrile: biological activities of R- and S-enantiomers on behavior and hormonal response to stress. Endocrinology 150 , 1817–1825 (2009).

Irwin, R. W. et al. Selective oestrogen receptor modulators differentially potentiate brain mitochondrial function. J. Neuroendocrinol. 24 , 236–248 (2012).

Ho, M. F. et al. Ketamine and ketamine metabolites as novel estrogen receptor ligands: Induction of cytochrome P450 and AMPA glutamate receptor gene expression. Biochem. Pharmacol. 152 , 279–292 (2018).

Hochol, A. et al. Effects of neuropeptides B and W on the rat pituitary-adrenocortical axis: in vivo and in vitro studies. Int J. Mol. Med. 19 , 207–211 (2007).

CAS   PubMed   Google Scholar  

Kurosawa, N., Shimizu, K. & Seki, K. The development of depression-like behavior is consolidated by IL-6-induced activation of locus coeruleus neurons and IL-1beta-induced elevated leptin levels in mice. Psychopharmacology 233 , 1725–1737 (2016).

Lee, J. Y. et al. The association between serum leptin levels and post-stroke depression: a retrospective clinical study. Ann. Rehabil. Med. 39 , 786–792 (2015).

Li, Z. et al. Fluoxetine improves behavioural deficits induced by chronic alcohol treatment by alleviating RNA editing of 5-HT(2C) receptors. Neurochem. Int. 134 , 104689 (2020).

de Morais, H. et al. Increased oxidative stress in prefrontal cortex and hippocampus is related to depressive-like behavior in streptozotocin-diabetic rats. Behav. Brain Res. 258 , 52–64 (2014).

Rawdin, B. J. et al. Dysregulated relationship of inflammation and oxidative stress in major depression. Brain Behav. Immun. 31 , 143–152 (2013).

Dringen, R. Metabolism and functions of glutathione in brain. Prog. Neurobiol. 62 , 649–671 (2000).

Greaney, J. L., Saunders, E. F. H. & Alexander, L. M. Short-term salicylate treatment improves microvascular endothelium-dependent dilation in young adults with major depressive disorder. Am. J. Physiol. Heart Circ. Physiol. 322 , H880–H889 (2022).

Belanger, M. & Magistretti, P. J. The role of astroglia in neuroprotection. Dialogues Clin. Neurosci. 11 , 281–295 (2009).

Chen, B. et al. The neuroprotective mechanism of lithium after ischaemic stroke. Commun. Biol. 5 , 105 (2022).

Maes, M. et al. Major differences in neurooxidative and neuronitrosative stress pathways between major depressive disorder and types I and II bipolar disorder. Mol. Neurobiol. 56 , 141–156 (2019).

Early, J. O. et al. Circadian clock protein BMAL1 regulates IL-1beta in macrophages via NRF2. Proc. Natl Acad. Sci. USA 115 , E8460–E8468 (2018).

Pasco, J. A. et al. Association of high-sensitivity C-reactive protein with de novo major depression. Br. J. Psychiatry 197 , 372–377 (2010).

Bakunina, N., Pariante, C. M. & Zunszain, P. A. Immune mechanisms linked to depression via oxidative stress and neuroprogression. Immunology 144 , 365–373 (2015).

Paul, E. R. et al. Peripheral and central kynurenine pathway abnormalities in major depression. Brain Behav. Immun. 101 , 136–145 (2022).

Wang, Y. et al. Inhibition of activated astrocyte ameliorates lipopolysaccharide- induced depressive-like behaviors. J. Affect Disord. 242 , 52–59 (2019).

Lenk, T., Rabet, S., Sprick, M., Raabe, G. & Schroder, U. Insight into the interaction of furfural with metallic surfaces in the electrochemical hydrogenation process. Chemphyschem 24 , e202200614 (2023).

Zhang, J. C., Yao, W. & Hashimoto, K. Brain-derived neurotrophic factor (BDNF)-TrkB signaling in inflammation-related depression and potential therapeutic targets. Curr. Neuropharmacol. 14 , 721–731 (2016).

Kennis, M. et al. Prospective biomarkers of major depressive disorder: a systematic review and meta-analysis. Mol. Psychiatry 25 , 321–338 (2020).

Norden, D. M., Trojanowski, P. J., Villanueva, E., Navarro, E. & Godbout, J. P. Sequential activation of microglia and astrocyte cytokine expression precedes increased Iba-1 or GFAP immunoreactivity following systemic immune challenge. Glia 64 , 300–316 (2016).

Li, X. et al. Leptin increases expression of 5-HT(2B) receptors in astrocytes thus enhancing action of fluoxetine on the depressive behavior induced by sleep deprivation. Front. Psychiatry 9 , 734 (2018).

Takano, K., Yamasaki, H., Kawabe, K., Moriyama, M. & Nakamura, Y. Imipramine induces brain-derived neurotrophic factor mRNA expression in cultured astrocytes. J. Pharmacol. Sci. 120 , 176–186 (2012).

Zhang, Y. et al. BDNF enhances electrophysiological activity and excitatory synaptic transmission of RA projection neurons in adult male zebra finches. Brain Res. 1801 , 148208 (2023).

Quesseveur, G. et al. BDNF overexpression in mouse hippocampal astrocytes promotes local neurogenesis and elicits anxiolytic-like activities. Transl. Psychiatry 3 , e253 (2013).

Zor, F. et al. Effect of VEGF gene therapy and hyaluronic acid film sheath on peripheral nerve regeneration. Microsurgery 34 , 209–216 (2014).

Sun, L. et al. Propofol directly induces caspase-1-dependent macrophage pyroptosis through the NLRP3-ASC inflammasome. Cell Death Dis. 10 , 542 (2019).

Alcocer-Gomez, E. & Cordero, M. D. NLRP3 inflammasome: a new target in major depressive disorder. CNS Neurosci. Ther. 20 , 294–295 (2014).

Beckwith, K. S. et al. Plasma membrane damage causes NLRP3 activation and pyroptosis during Mycobacterium tuberculosis infection. Nat. Commun. 11 , 2270 (2020).

Xia, M. et al. The ameliorative effect of fluoxetine on neuroinflammation induced by sleep deprivation. J. Neurochem. 146 , 63–75 (2018).

Jeon, S. A. et al. NLRP3 inflammasome contributes to lipopolysaccharide-induced depressive-like behaviors via indoleamine 2,3-dioxygenase induction. Int. J. Neuropsychopharmacol. 20 , 896–906 (2017).

Wong, M. L. et al. Inflammasome signaling affects anxiety- and depressive-like behavior and gut microbiome composition. Mol. Psychiatry 21 , 797–805 (2016).

Page, C. E. & Coutellier, L. Prefrontal excitatory/inhibitory balance in stress and emotional disorders: Evidence for over-inhibition. Neurosci. Biobehav. Rev. 105 , 39–51 (2019).

Santello, M., Toni, N. & Volterra, A. Astrocyte function from information processing to cognition and cognitive impairment. Nat. Neurosci. 22 , 154–166 (2019).

Castillo-Gomez, E., Perez-Rando, M., Vidueira, S. & Nacher, J. Polysialic acid acute depletion induces structural plasticity in interneurons and impairs the excitation/inhibition balance in medial prefrontal cortex organotypic cultures. Front. Cell. Neurosci. 10 , 170 (2016).

Haydon, P. G. & Carmignoto, G. Astrocyte control of synaptic transmission and neurovascular coupling. Physiol. Rev. 86 , 1009–1031 (2006).

Huang, D. et al. Dysfunction of astrocytic connexins 30 and 43 in the medial prefrontal cortex and hippocampus mediates depressive-like behaviours. Behav. Brain Res. 372 , 111950 (2019).

Nagy, C., Torres-Platas, S. G., Mechawar, N. & Turecki, G. Repression of astrocytic connexins in cortical and subcortical brain regions and prefrontal enrichment of H3K9me3 in depression and suicide. Int J. Neuropsychopharmacol. 20 , 50–57 (2017).

PubMed   Google Scholar  

Murphy-Royal, C. et al. Stress gates an astrocytic energy reservoir to impair synaptic plasticity. Nat. Commun. 11 , 2014 (2020).

Ezan, P. et al. Deletion of astroglial connexins weakens the blood-brain barrier. J. Cereb. Blood Flow Metab. 32 , 1457–1467 (2012).

Torres-Platas, S. G., Nagy, C., Wakid, M., Turecki, G. & Mechawar, N. Glial fibrillary acidic protein is differentially expressed across cortical and subcortical regions in healthy brains and downregulated in the thalamus and caudate nucleus of depressed suicides. Mol. Psychiatry 21 , 509–515 (2016).

Cobb, J. A. et al. Density of GFAP-immunoreactive astrocytes is decreased in left hippocampi in major depressive disorder. Neuroscience 316 , 209–220 (2016).

Steinacker, P. et al. Glial fibrillary acidic protein as blood biomarker for differential diagnosis and severity of major depressive disorder. J. Psychiatr. Res. 144 , 54–58 (2021).

Rajkowska, G., Hughes, J., Stockmeier, C. A., Javier Miguel-Hidalgo, J. & Maciag, D. Coverage of blood vessels by astrocytic endfeet is reduced in major depressive disorder. Biol. Psychiatry 73 , 613–621 (2013).

Rajkowska, G. & Miguel-Hidalgo, J. J. Glial pathology in major depressive disorder: an approach to investigate the coverage of blood vessels by astrocyte endfeet in human postmortem brain. Methods Mol. Biol. 1938 , 247–254 (2019).

Kong, H. et al. Aquaporin-4 knockout exacerbates corticosterone-induced depression by inhibiting astrocyte function and hippocampal neurogenesis. CNS Neurosci. Ther. 20 , 391–402 (2014).

Xia, M., Yang, L., Sun, G., Qi, S. & Li, B. Mechanism of depression as a risk factor in the development of Alzheimer’s disease: the function of AQP4 and the glymphatic system. Psychopharmacology 234 , 365–379 (2017).

Di Benedetto, B. et al. Fluoxetine requires the endfeet protein aquaporin-4 to enhance plasticity of astrocyte processes. Front. Cell. Neurosci. 10 , 8 (2016).

Du, J. et al. S100B is selectively expressed by gray matter protoplasmic astrocytes and myelinating oligodendrocytes in the developing CNS. Mol. Brain 14 , 154 (2021).

Schroeter, M. L., Abdul-Khaliq, H., Krebs, M., Diefenbacher, A. & Blasig, I. E. Serum markers support disease-specific glial pathology in major depression. J. Affect Disord. 111 , 271–280 (2008).

Michel, M. et al. Increased GFAP concentrations in the cerebrospinal fluid of patients with unipolar depression. Transl. Psychiatry 11 , 308 (2021).

Gos, T. et al. S100B-immunopositive astrocytes and oligodendrocytes in the hippocampus are differentially afflicted in unipolar and bipolar depression: a postmortem study. J. Psychiatr. Res. 47 , 1694–1699 (2013).

Michetti, F. et al. The S100B protein in biological fluids: more than a lifelong biomarker of brain distress. J. Neurochem. 120 , 644–659 (2012).

Zhang, L. et al. Changes in glial gene expression in the prefrontal cortex in relation to major depressive disorder, suicide and psychotic features. J. Affect Disord. 295 , 893–903 (2021).

Gules, E., Iosifescu, D. V. & Tural, U. Plasma neuronal and glial markers and anterior cingulate metabolite levels in major depressive disorder: a pilot study. Neuropsychobiology 79 , 214–221 (2020).

Chamera, K., Szuster-Gluszczak, M., Trojan, E. & Basta-Kaim, A. Maternal Immune Activation Sensitizes Male Offspring Rats to Lipopolysaccharide-Induced Microglial Deficits Involving the Dysfunction of CD200-CD200R and CX3CL1-CX3CR1 systems. Cells 9 , 1676 (2020).

Jiang, X. et al. Asperosaponin VI ameliorates the CMS-induced depressive-like behaviors by inducing a neuroprotective microglial phenotype in hippocampus via PPAR-gamma pathway. J. Neuroinflammation 19 , 115 (2022).

Tang, M. M., Lin, W. J., Pan, Y. Q. & Li, Y. C. Fibroblast growth factor 2 modulates hippocampal microglia activation in a neuroinflammation induced model of depression. Front. Cell. Neurosci. 12 , 255 (2018).

Zhan, Y. et al. Deficient neuron-microglia signaling results in impaired functional brain connectivity and social behavior. Nat. Neurosci. 17 , 400–406 (2014).

Hellwig, S. et al. Altered microglia morphology and higher resilience to stress-induced depression-like behavior in CX3CR1-deficient mice. Brain Behav. Immun. 55 , 126–137 (2016).

Merendino, R. A. et al. Involvement of fractalkine and macrophage inflammatory protein-1 alpha in moderate-severe depression. Mediat. Inflamm. 13 , 205–207 (2004).

Garcia-Marchena, N. et al. Inflammatory mediators and dual depression: Potential biomarkers in plasma of primary and substance-induced major depression in cocaine and alcohol use disorders. PLoS ONE 14 , e0213791 (2019).

Wang, H. T. et al. Early-Life Social Isolation-Induced Depressive-Like Behavior in Rats Results in Microglial Activation and Neuronal Histone Methylation that Are Mitigated by Minocycline. Neurotox. Res 31 , 505–520 (2017).

Frank, M. G., Fonken, L. K., Annis, J. L., Watkins, L. R. & Maier, S. F. Stress disinhibits microglia via down-regulation of CD200R: A mechanism of neuroinflammatory priming. Brain Behav. Immun. 69 , 62–73 (2018).

Fonken, L. K. et al. Neuroinflammatory priming to stress is differentially regulated in male and female rats. Brain Behav. Immun. 70 , 257–267 (2018).

Popov, A. et al. Astrocyte dystrophy in ageing brain parallels impaired synaptic plasticity. Aging Cell 20 , e13334 (2021).

Zhang, Y. et al. Structural basis of ketamine action on human NMDA receptors. Nature 596 , 301–305 (2021).

Wang, Q., Jie, W., Liu, J. H., Yang, J. M. & Gao, T. M. An astroglial basis of major depressive disorder? An overview. Glia 65 , 1227–1250 (2017).

Jiang, X., Lin, W., Cheng, Y. & Wang, D. mGluR5 facilitates long-term synaptic depression in a stress-induced depressive mouse model. Can. J. Psychiatry 65 , 347–355 (2020).

Guo, W. et al. Iptakalim alleviates synaptic damages via targeting mitochondrial ATP-sensitive potassium channel in depression. FASEB J. 35 , e21581 (2021).

Curro, D., Navarra, P., Samengo, I. & Martire, M. P2X7 receptors exert a permissive effect on the activation of presynaptic AMPA receptors in rat trigeminal caudal nucleus glutamatergic nerve terminals. J. Headache Pain 21 , 83 (2020).

Iwata, M. et al. Psychological stress activates the inflammasome via release of adenosine triphosphate and stimulation of the purinergic type 2X7 receptor. Biol. Psychiatry 80 , 12–22 (2016).

He, Y., Taylor, N., Fourgeaud, L. & Bhattacharya, A. The role of microglial P2X7: modulation of cell death and cytokine release. J. Neuroinflammation 14 , 135 (2017).

Ota, K. T. et al. REDD1 is essential for stress-induced synaptic loss and depressive behavior. Nat. Med 20 , 531–535 (2014).

Kang, H. J. et al. Decreased expression of synapse-related genes and loss of synapses in major depressive disorder. Nat. Med 18 , 1413–1417 (2012).

Tomassoni-Ardori, F. et al. Rbfox1 up-regulation impairs BDNF-dependent hippocampal LTP by dysregulating TrkB isoform expression levels. Elife 8 , e49673 (2019).

Wang, G. et al. Antidepressant-like effect of ginsenoside Rb1 on potentiating synaptic plasticity via the miR-134-mediated BDNF signaling pathway in a mouse model of chronic stress-induced depression. J. Ginseng Res. 46 , 376–386 (2022).

Lalo, U., Koh, W., Lee, C. J. & Pankratov, Y. The tripartite glutamatergic synapse. Neuropharmacology 199 , 108758 (2021).

Shepard, R., Page, C. E. & Coutellier, L. Sensitivity of the prefrontal GABAergic system to chronic stress in male and female mice: Relevance for sex differences in stress-related disorders. Neuroscience 332 , 1–12 (2016).

Shepard, R. & Coutellier, L. Changes in the prefrontal glutamatergic and parvalbumin systems of mice exposed to unpredictable chronic stress. Mol. Neurobiol. 55 , 2591–2602 (2018).

Bouamrane, L. et al. Reelin-haploinsufficiency disrupts the developmental trajectory of the E/I Balance in the Prefrontal Cortex. Front. Cell. Neurosci. 10 , 308 (2016).

Arnone, D., Mumuni, A. N., Jauhar, S., Condon, B. & Cavanagh, J. Indirect evidence of selective glial involvement in glutamate-based mechanisms of mood regulation in depression: meta-analysis of absolute prefrontal neuro-metabolic concentrations. Eur. Neuropsychopharmacol. 25 , 1109–1117 (2015).

Hu, Y. T., Tan, Z. L., Hirjak, D. & Northoff, G. Brain-wide changes in excitation-inhibition balance of major depressive disorder: a systematic review of topographic patterns of GABA- and glutamatergic alterations. Mol. Psychiatry 28 , 3257–3266 (2023).

Zhao, J. et al. Prefrontal alterations in GABAergic and glutamatergic gene expression in relation to depression and suicide. J. Psychiatr. Res. 102 , 261–274 (2018).

Douillard-Guilloux, G., Lewis, D., Seney, M. L. & Sibille, E. Decrease in somatostatin-positive cell density in the amygdala of females with major depression. Depress Anxiety 34 , 68–78 (2017).

Scifo, E. et al. Sustained molecular pathology across episodes and remission in major depressive disorder. Biol. Psychiatry 83 , 81–89 (2018).

Oh, D. H., Son, H., Hwang, S. & Kim, S. H. Neuropathological abnormalities of astrocytes, GABAergic neurons, and pyramidal neurons in the dorsolateral prefrontal cortices of patients with major depressive disorder. Eur. Neuropsychopharmacol. 22 , 330–338 (2012).

Sibille, E., Morris, H. M., Kota, R. S. & Lewis, D. A. GABA-related transcripts in the dorsolateral prefrontal cortex in mood disorders. Int J. Neuropsychopharmacol. 14 , 721–734 (2011).

Barros-Barbosa, A. R., Lobo, M. G., Ferreirinha, F., Correia-de-Sa, P. & Cordeiro, J. M. P2X7 receptor activation downmodulates Na(+)-dependent high-affinity GABA and glutamate transport into rat brain cortex synaptosomes. Neuroscience 306 , 74–90 (2015).

Barros-Barbosa, A. R. et al. Up-regulation of P2X7 receptor-mediated inhibition of GABA uptake by nerve terminals of the human epileptic neocortex. Epilepsia 57 , 99–110 (2016).

Liu, Y. P., Yang, C. S., Chen, M. C., Sun, S. H. & Tzeng, S. F. Ca(2+)-dependent reduction of glutamate aspartate transporter GLAST expression in astrocytes by P2X(7) receptor-mediated phosphoinositide 3-kinase signaling. J. Neurochem. 113 , 213–227 (2010).

Macaulay, N. & Zeuthen, T. Glial K(+) clearance and cell swelling: key roles for cotransporters and pumps. Neurochem. Res. 37 , 2299–2309 (2012).

Larsen, B. R. et al. Contributions of the Na(+)/K(+)-ATPase, NKCC1, and Kir4.1 to hippocampal K(+) clearance and volume responses. Glia 62 , 608–622 (2014).

Verkhratsky, A. & Nedergaard, M. Astroglial cradle in the life of the synapse. Philos. Trans. R. Soc. Lond. B Biol. Sci. 369 , 20130595 (2014).

Aramideh, J. A., Vidal-Itriago, A., Morsch, M. & Graeber, M. B. Cytokine signalling at the microglial penta-partite synapse. Int J. Mol. Sci. 22 , 13186 (2021).

Chung, W. S. et al. Astrocytes mediate synapse elimination through MEGF10 and MERTK pathways. Nature 504 , 394–400 (2013).

Yang, J. et al. Astrocytes contribute to synapse elimination via type 2 inositol 1,4,5-trisphosphate receptor-dependent release of ATP. Elife 5 , e15043 (2016).

Petrache, A. L. et al. Aberrant excitatory-inhibitory synaptic mechanisms in entorhinal cortex microcircuits during the pathogenesis of Alzheimer’s disease. Cereb. Cortex 29 , 1834–1850 (2019).

Arioz, B. I. et al. Melatonin attenuates LPS-Induced acute depressive-like behaviors and microglial NLRP3 inflammasome activation through the SIRT1/Nrf2 pathway. Front. Immunol. 10 , 1511 (2019).

Bikbaev, A., Frischknecht, R. & Heine, M. Brain extracellular matrix retains connectivity in neuronal networks. Sci. Rep. 5 , 14527 (2015).

Strackeljan, L. et al. Microglia depletion-induced remodeling of extracellular matrix and excitatory synapses in the hippocampus of adult mice. Cells 10 , 1862 (2021).

Leclercq, S., De Saeger, C., Delzenne, N., de Timary, P. & Starkel, P. Role of inflammatory pathways, blood mononuclear cells, and gut-derived bacterial products in alcohol dependence. Biol. Psychiatry 76 , 725–733 (2014).

Hsu, J. H., Chien, I. C. & Lin, C. H. Increased risk of chronic liver disease in patients with major depressive disorder: a population-based study. J. Affect Disord. 251 , 180–185 (2019).

Chen, D., Zhang, Y., Huang, T. & Jia, J. Depression and risk of gastrointestinal disorders: a comprehensive two-sample Mendelian randomization study of European ancestry. Psychol. Med . 53 , 7309–7321 (2023).

Facanali, C. B. G. et al. The relationship of major depressive disorder with Crohn’s disease activity. Clinics (Sao Paulo) 78 , 100188 (2023).

Ronaldson, P. T. & Davis, T. P. Regulation of blood-brain barrier integrity by microglia in health and disease: A therapeutic opportunity. J. Cereb. Blood Flow. Metab. 40 , S6–S24 (2020).

Qing, H. et al. Origin and Function of Stress-Induced IL-6 in Murine Models. Cell 182 , 1660 (2020).

Labad, J. et al. Hypothalamic-pituitary-adrenal axis function and exposure to stress factors and cannabis use in recent-onset psychosis. World J. Biol. Psychiatry 21 , 564–571 (2020).

Frank, M. G., Miguel, Z. D., Watkins, L. R. & Maier, S. F. Prior exposure to glucocorticoids sensitizes the neuroinflammatory and peripheral inflammatory responses to E. coli lipopolysaccharide. Brain Behav. Immun. 24 , 19–30 (2010).

Deng, Y. et al. Involvement of the microbiota-gut-brain axis in chronic restraint stress: disturbances of the kynurenine metabolic pathway in both the gut and brain. Gut Microbes 13 , 1–16 (2021).

Munn, D. H. & Mellor, A. L. Indoleamine 2,3 dioxygenase and metabolic control of immune responses. Trends Immunol. 34 , 137–143 (2013).

Gos, T. et al. Reduced microglial immunoreactivity for endogenous NMDA receptor agonist quinolinic acid in the hippocampus of schizophrenia patients. Brain Behav. Immun. 41 , 59–64 (2014).

Li, M. et al. Transcriptome profiles of corticosterone-induced cytotoxicity reveals the involvement of neurite growth-related genes in depression. Psychiatry Res. 276 , 79–86 (2019).

Dutheil, S., Ota, K. T., Wohleb, E. S., Rasmussen, K. & Duman, R. S. High-fat diet induced anxiety and anhedonia: impact on brain homeostasis and inflammation. Neuropsychopharmacology 41 , 1874–1887 (2016).

Skonieczna-Zydecka, K. et al. Faecal short chain fatty acids profile is changed in polish depressive women. Nutrients 10 , 1939 (2018).

Sampson, T. R. et al. Gut microbiota regulate motor deficits and neuroinflammation in a model of Parkinson’s disease. Cell 167 , 1469–1480.e1412 (2016).

Fan, L. et al. Total glycosides from stems of Cistanche tubulosa alleviate depression-like behaviors: bidirectional interaction of the phytochemicals and gut microbiota. Phytomedicine 83 , 153471 (2021).

Zhang, J. C. et al. Blockade of interleukin-6 receptor in the periphery promotes rapid and sustained antidepressant actions: a possible role of gut-microbiota-brain axis. Transl. Psychiatry 7 , e1138 (2017).

Pan, Y., Chen, X. Y., Zhang, Q. Y. & Kong, L. D. Microglial NLRP3 inflammasome activation mediates IL-1beta-related inflammation in prefrontal cortex of depressive rats. Brain Behav. Immun. 41 , 90–100 (2014).

Woodburn, S. C., Bollinger, J. L. & Wohleb, E. S. Synaptic and behavioral effects of chronic stress are linked to dynamic and sex-specific changes in microglia function and astrocyte dystrophy. Neurobiol. Stress 14 , 100312 (2021).

Zhang, K., Liu, R., Gao, Y., Ma, W. & Shen, W. Electroacupuncture relieves LPS-induced depression-like behaviour in rats through IDO-Mediated tryptophan-degrading pathway. Neuropsychiatr. Dis. Treat. 16 , 2257–2266 (2020).

Parrott, J. M., Redus, L. & O’Connor, J. C. Kynurenine metabolic balance is disrupted in the hippocampus following peripheral lipopolysaccharide challenge. J. Neuroinflammation 13 , 124 (2016).

Alzarea, S., Abbas, M., Ronan, P. J., Lutfy, K. & Rahman, S. The Effect of an alpha-7 nicotinic allosteric modulator PNU120596 and NMDA receptor antagonist memantine on depressive-like behavior induced by lps in mice: the involvement of brain microglia. Brain Sci. 12 , 1493 (2022).

Le Strat, Y., Le Foll, B. & Dubertret, C. Major depression and suicide attempts in patients with liver disease in the United States. Liver Int. 35 , 1910–1916 (2015).

Buganza-Torio, E. et al. Depression in cirrhosis - a prospective evaluation of the prevalence, predictors and development of a screening nomogram. Aliment. Pharmacol. Ther. 49 , 194–201 (2019).

Qin, X. H. et al. Liver soluble epoxide hydrolase regulates behavioral and cellular effects of chronic stress. Cell Rep. 29 , 3223–3234.e3226 (2019).

Pang, F. et al. Electroacupuncture alleviates depressive-like behavior by modulating the expression of P2X7/NLRP3/IL-1beta of prefrontal cortex and liver in rats exposed to chronic unpredictable mild stress. Brain Sci. 13 , 436 (2023).

Zhang, Y. et al. Effects of hydrogen-rich water on depressive-like behavior in mice. Sci. Rep. 6 , 23742 (2016).

Brown, S. J. et al. Sex- and suicide-specific alterations in the kynurenine pathway in the anterior cingulate cortex in major depression. Neuropsychopharmacology (2023). Online ahead of print.

Guillemin, G. J. et al. Characterisation of kynurenine pathway metabolism in human astrocytes and implications in neuropathogenesis. Redox Rep. 5 , 108–111 (2000).

Park, H. J., Kim, S. A., Kang, W. S. & Kim, J. W. Early-life stress modulates gut microbiota and peripheral and central inflammation in a sex-dependent manner. Int J. Mol. Sci. 22 , 1899 (2021).

Ninan, J. & Feldman, L. Ammonia levels and hepatic encephalopathy in patients with known chronic liver disease. J. Hosp. Med. 12 , 659–661 (2017).

Kautzky, A. et al. The influence of the rs6295 gene polymorphism on serotonin-1A receptor distribution investigated with PET in patients with major depression applying machine learning. Transl. Psychiatry 7 , e1150 (2017).

Das, R. et al. Higher levels of serum IL-1beta and TNF-alpha are associated with an increased probability of major depressive disorder. Psychiatry Res. 295 , 113568 (2021).

Lu, Z. et al. Oxidative stress and psychiatric disorders: evidence from the bidirectional mendelian randomization study. Antioxidants (Basel) 11 , 1386 (2022).

Hursitoglu, O. et al. Serum NOX1 and Raftlin as new potential biomarkers of Major Depressive Disorder: a study in treatment-naive first episode patients. Prog. Neuropsychopharmacol. Biol. Psychiatry 121 , 110670 (2023).

Han, K. M. et al. Serum FAM19A5 levels: A novel biomarker for neuroinflammation and neurodegeneration in major depressive disorder. Brain Behav. Immun. 87 , 852–859 (2020).

Winter, N. R. et al. Quantifying deviations of brain structure and function in major depressive disorder across neuroimaging modalities. JAMA Psychiatry 79 , 879–888 (2022).

Zhao, Y. et al. Gray matter abnormalities in non-comorbid medication-naive patients with major depressive disorder or social anxiety disorder. EBioMedicine 21 , 228–235 (2017).

Wise, T. et al. Common and distinct patterns of grey-matter volume alteration in major depression and bipolar disorder: evidence from voxel-based meta-analysis. Mol. Psychiatry 22 , 1455–1463 (2017).

Liu, Y. et al. Abnormal brain gray matter volume in patients with major depressive disorder: Associated with childhood trauma? J. Affect Disord. 308 , 562–568 (2022).

Kaiser, R. H., Andrews-Hanna, J. R., Wager, T. D. & Pizzagalli, D. A. Large-scale network dysfunction in major depressive disorder: a meta-analysis of resting-state functional connectivity. JAMA Psychiatry 72 , 603–611 (2015).

Wang, Y. et al. Topologically convergent and divergent functional connectivity patterns in unmedicated unipolar depression and bipolar disorder. Transl. Psychiatry 7 , e1165 (2017).

Kremneva, E. I., Sinitsyn, D. O., Dobrynina, L. A., Suslina, A. D. & Krotenkova, M. V. [Resting state functional MRI in neurology and psychiatry]. Zh. Nevrol. Psikhiatr Im. S S Korsakova 122 , 5–14 (2022).

Luo, Z. et al. Shared and specific dynamics of brain segregation and integration in bipolar disorder and major depressive disorder: A resting-state functional magnetic resonance imaging study. J. Affect. Disord. 280 , 279–286 (2021).

Drysdale, A. T. et al. Resting-state connectivity biomarkers define neurophysiological subtypes of depression. Nat. Med. 23 , 28–38 (2017).

Chen, Q. et al. Regional amplitude abnormities in the major depressive disorder: A resting-state fMRI study and support vector machine analysis. J. Affect. Disord. 308 , 1–9 (2022).

Yan, C. G. et al. Reduced default mode network functional connectivity in patients with recurrent major depressive disorder. Proc. Natl Acad. Sci. USA 116 , 9078–9083 (2019).

Pizzagalli, D. A. & Roberts, A. C. Prefrontal cortex and depression. Neuropsychopharmacology 47 , 225–246 (2022).

Muller, V. I. et al. Altered brain activity in unipolar depression revisited: meta-analyses of neuroimaging studies. JAMA Psychiatry 74 , 47–55 (2017).

Sun, K. et al. A two-center radiomic analysis for differentiating major depressive disorder using multi-modality MRI data under different parcellation methods. J. Affect. Disord. 300 , 1–9 (2022).

Mayerhoefer, M. E. et al. Introduction to radiomics. J. Nucl. Med. 61 , 488–495 (2020).

Xu, Z. et al. Combined HTR1A/1B methylation and human functional connectome to recognize patients with MDD. Psychiatry Res. 317 , 114842 (2022).

Verduijn, J. et al. Reconsidering the prognosis of major depressive disorder across diagnostic boundaries: full recovery is the exception rather than the rule. BMC Med. 15 , 215 (2017).

Blumenthal, J. A. & Rozanski, A. Exercise as a therapeutic modality for the prevention and treatment of depression. Prog. Cardiovasc. Dis. 77 , 50–58 (2023).

Baglioni, C., Spiegelhalder, K., Nissen, C. & Riemann, D. Clinical implications of the causal relationship between insomnia and depression: how individually tailored treatment of sleeping difficulties could prevent the onset of depression. EPMA J. 2 , 287–293 (2011).

Riemann, D. et al. European guideline for the diagnosis and treatment of insomnia. J. Sleep. Res. 26 , 675–700 (2017).

Soh, H. L., Ho, R. C., Ho, C. S. & Tam, W. W. Efficacy of digital cognitive behavioural therapy for insomnia: a meta-analysis of randomised controlled trials. Sleep. Med. 75 , 315–325 (2020).

Ho, F. Y., Chan, C. S., Lo, W. Y. & Leung, J. C. The effect of self-help cognitive behavioral therapy for insomnia on depressive symptoms: an updated meta-analysis of randomized controlled trials. J. Affect. Disord. 265 , 287–304 (2020).

Qaseem, A. et al. Management of chronic insomnia disorder in adults: a clinical practice guideline from the american college of physicians. Ann. Intern. Med. 165 , 125–133 (2016).

Irwin, M. R. et al. Prevention of incident and recurrent major depression in older adults with insomnia: a randomized clinical trial. JAMA Psychiatry 79 , 33–41 (2022).

Scheer, F. A., Pirovano, C., Van Someren, E. J. & Buijs, R. M. Environmental light and suprachiasmatic nucleus interact in the regulation of body temperature. Neuroscience 132 , 465–477 (2005).

Dekker, K. et al. Combined internet-based cognitive-behavioral and chronobiological intervention for insomnia: a randomized controlled trial. Psychother. Psychosom. 89 , 117–118 (2020).

Leerssen, J. et al. Treating insomnia with high risk of depression using therapist-guided digital cognitive, behavioral, and circadian rhythm support interventions to prevent worsening of depressive symptoms: a randomized controlled trial. Psychother. Psychosom. 91 , 168–179 (2022).

Zhai, L., Zhang, H. & Zhang, D. Sleep duration and depression among adults: a meta-analysis of prospective studies. Depress. Anxiety 32 , 664–670 (2015).

Baglioni, C. et al. Insomnia as a predictor of depression: a meta-analytic evaluation of longitudinal epidemiological studies. J. Affect. Disord. 135 , 10–19 (2011).

Utge, S. J. et al. Systematic analysis of circadian genes in a population-based sample reveals association of TIMELESS with depression and sleep disturbance. PLoS ONE 5 , e9259 (2010).

Irwin, M. R. Sleep and inflammation: partners in sickness and in health. Nat. Rev. Immunol. 19 , 702–715 (2019).

Hill Almeida, L. M. et al. Disrupted sleep and risk of depression in later life: A prospective cohort study with extended follow up and a systematic review and meta-analysis. J. Affect. Disord. 309 , 314–323 (2022).

Tolkien, K., Bradburn, S. & Murgatroyd, C. An anti-inflammatory diet as a potential intervention for depressive disorders: A systematic review and meta-analysis. Clin. Nutr. 38 , 2045–2052 (2019).

Galland, L. Diet and inflammation. Nutr. Clin. Pr. 25 , 634–640 (2010).

Oddy, W. H. et al. Dietary patterns, body mass index and inflammation: Pathways to depression and mental health problems in adolescents. Brain Behav. Immun. 69 , 428–439 (2018).

Bosma-den Boer, M. M., van Wetten, M. L. & Pruimboom, L. Chronic inflammatory diseases are stimulated by current lifestyle: how diet, stress levels and medication prevent our body from recovering. Nutr. Metab. (Lond.) 9 , 32 (2012).

Sanchez-Villegas, A. et al. The effect of the Mediterranean diet on plasma brain-derived neurotrophic factor (BDNF) levels: the PREDIMED-NAVARRA randomized trial. Nutr. Neurosci. 14 , 195–201 (2011).

Jiang, C. & Salton, S. R. The role of neurotrophins in major depressive disorder. Transl. Neurosci. 4 , 46–58 (2013).

Ogbonnaya, E. S. et al. Adult hippocampal neurogenesis is regulated by the microbiome. Biol. Psychiatry 78 , e7–9 (2015).

Zheng, P. et al. Gut microbiome remodeling induces depressive-like behaviors through a pathway mediated by the host’s metabolism. Mol. Psychiatry 21 , 786–796 (2016).

Jiang, H. et al. Altered fecal microbiota composition in patients with major depressive disorder. Brain Behav. Immun. 48 , 186–194 (2015).

Burokas, A. et al. Targeting the microbiota-gut-brain axis: prebiotics have anxiolytic and antidepressant-like effects and reverse the impact of chronic stress in mice. Biol. Psychiatry 82 , 472–487 (2017).

Bonder, M. J. et al. The influence of a short-term gluten-free diet on the human gut microbiome. Genome Med. 8 , 45 (2016).

Mohan, M. et al. Dietary gluten-induced gut dysbiosis is accompanied by selective upregulation of microRNAs with intestinal tight junction and bacteria-binding motifs in rhesus macaque model of celiac disease. Nutrients 8 , 684 (2016).

Karakula-Juchnowicz, H. et al. The study evaluating the effect of probiotic supplementation on the mental status, inflammation, and intestinal barrier in major depressive disorder patients using gluten-free or gluten-containing diet (SANGUT study): a 12-week, randomized, double-blind, and placebo-controlled clinical study protocol. Nutr. J. 18 , 50 (2019).

Khosravi, M. et al. The relationship between dietary patterns and depression mediated by serum levels of Folate and vitamin B12. BMC Psychiatry 20 , 63 (2020).

Schuch, F. B. et al. Exercise as a treatment for depression: a meta-analysis adjusting for publication bias. J. Psychiatr. Res. 77 , 42–51 (2016).

Morland, C. et al. Exercise induces cerebral VEGF and angiogenesis via the lactate receptor HCAR1. Nat. Commun. 8 , 15557 (2017).

Coelho, F. G. et al. Physical exercise modulates peripheral levels of brain-derived neurotrophic factor (BDNF): a systematic review of experimental studies in the elderly. Arch. Gerontol. Geriatr. 56 , 10–15 (2013).

Stimpson, N. J., Davison, G. & Javadi, A. H. Joggin’ the noggin: towards a physiological understanding of exercise-induced cognitive benefits. Neurosci. Biobehav Rev. 88 , 177–186 (2018).

De Rossi, P. et al. A critical role for VEGF and VEGFR2 in NMDA receptor synaptic function and fear-related behavior. Mol. Psychiatry 21 , 1768–1780 (2016).

Bugg, J. M. & Head, D. Exercise moderates age-related atrophy of the medial temporal lobe. Neurobiol. Aging 32 , 506–514 (2011).

Cole, R. C. et al. Cardiorespiratory fitness and hippocampal volume predict faster episodic associative learning in older adults. Hippocampus 30 , 143–155 (2020).

Zotcheva, E. et al. Associations of changes in cardiorespiratory fitness and symptoms of anxiety and depression with brain volumes: The HUNT Study. Front Behav. Neurosci. 13 , 53 (2019).

Dowlati, Y. et al. A meta-analysis of cytokines in major depression. Biol. Psychiatry 67 , 446–457 (2010).

Valkanova, V., Ebmeier, K. P. & Allan, C. L. CRP, IL-6 and depression: a systematic review and meta-analysis of longitudinal studies. J. Affect Disord. 150 , 736–744 (2013).

Kohler, C. A. et al. Peripheral cytokine and chemokine alterations in depression: a meta-analysis of 82 studies. Acta Psychiatr. Scand. 135 , 373–387 (2017).

Choi, K. W. et al. Assessment of bidirectional relationships between physical activity and depression among adults: a 2-sample mendelian randomization study. JAMA Psychiatry 76 , 399–408 (2019).

Schuch, F. B. et al. Physical activity and incident depression: a meta-analysis of prospective cohort studies. Am. J. Psychiatry 175 , 631–648 (2018).

Choi, K. W. et al. Physical activity offsets genetic risk for incident depression assessed via electronic health records in a biobank cohort study. Depress Anxiety 37 , 106–114 (2020).

Imboden, C. et al. Aerobic exercise or stretching as add-on to inpatient treatment of depression: Similar antidepressant effects on depressive symptoms and larger effects on working memory for aerobic exercise alone. J. Affect Disord. 276 , 866–876 (2020).

Vancampfort, D. et al. Sedentary behavior and physical activity levels in people with schizophrenia, bipolar disorder and major depressive disorder: a global systematic review and meta-analysis. World Psychiatry 16 , 308–315 (2017).

Brush, C. J. et al. A randomized trial of aerobic exercise for major depression: examining neural indicators of reward and cognitive control as predictors and treatment targets. Psychol. Med. 52 , 893–903 (2022).

Kujawa, A. et al. Reduced reward responsiveness predicts change in depressive symptoms in anxious children and adolescents following treatment. J. Child Adolesc. Psychopharmacol. 29 , 378–385 (2019).

Kandola, A., Ashdown-Franks, G., Hendrikse, J., Sabiston, C. M. & Stubbs, B. Physical activity and depression: towards understanding the antidepressant mechanisms of physical activity. Neurosci. Biobehav Rev. 107 , 525–539 (2019).

Yildirim, Y. & Kocabiyik, S. The relationship between social support and loneliness in Turkish patients with cancer. J. Clin. Nurs. 19 , 832–839 (2010).

Lin, J. et al. Perceived stressfulness mediates the effects of subjective social support and negative coping style on suicide risk in Chinese patients with major depressive disorder. J. Affect. Disord. 265 , 32–38 (2020).

Smith, L., Hill, N. & Kokanovic, R. Experiences of depression, the role of social support and its impact on health outcomes. J. Ment. Health 24 , 342–346 (2015).

Wang, X., Cai, L., Qian, J. & Peng, J. Social support moderates stress effects on depression. Int. J. Ment. Health Syst. 8 , 41 (2014).

Hybels, C. F., Pieper, C. F., Blazer, D. G. & Steffens, D. C. Heterogeneity in the three-year course of major depression among older adults. Int. J. Geriatr. Psychiatry 31 , 775–782 (2016).

Backs-Dermott, B. J., Dobson, K. S. & Jones, S. L. An evaluation of an integrated model of relapse in depression. J. Affect. Disord. 124 , 60–67 (2010).

Holma, I. A., Holma, K. M., Melartin, T. K., Rytsala, H. J. & Isometsa, E. T. A 5-year prospective study of predictors for disability pension among patients with major depressive disorder. Acta Psychiatr. Scand. 125 , 325–334 (2012).

Stewart, R. A., Patel, T. A., McDermott, K. A. & Cougle, J. R. Functional and structural social support in DSM-5 mood and anxiety disorders: a population-based study. J. Affect Disord. 308 , 528–534 (2022).

Ouakinin, S. R. S., Barreira, D. P. & Gois, C. J. Depression and obesity: integrating the role of stress, neuroendocrine dysfunction and inflammatory pathways. Front. Endocrinol. (Lausanne) 9 , 431 (2018).

Hallgren, M., Lundin, A., Tee, F. Y., Burstrom, B. & Forsell, Y. Somebody to lean on: Social relationships predict post-treatment depression severity in adults. Psychiatry Res. 249 , 261–267 (2017).

van Beljouw, I. M., Verhaak, P. F., Cuijpers, P., van Marwijk, H. W. & Penninx, B. W. The course of untreated anxiety and depression, and determinants of poor one-year outcome: a one-year cohort study. BMC Psychiatry 10 , 86 (2010).

Dour, H. J. et al. Perceived social support mediates anxiety and depressive symptom changes following primary care intervention. Depress Anxiety 31 , 436–442 (2014).

Teo, A. R., Choi, H. & Valenstein, M. Social relationships and depression: ten-year follow-up from a nationally representative study. PLoS ONE 8 , e62396 (2013).

Griffiths, K. M., Crisp, D. A., Barney, L. & Reid, R. Seeking help for depression from family and friends: a qualitative analysis of perceived advantages and disadvantages. BMC Psychiatry 11 , 196 (2011).

Hillhouse, T. M. & Porter, J. H. A brief history of the development of antidepressant drugs: from monoamines to glutamate. Exp. Clin. Psychopharmacol. 23 , 1–21 (2015).

Sulser, F., Vetulani, J. & Mobley, P. L. Mode of action of antidepressant drugs. Biochem. Pharmacol. 27 , 257–261 (1978).

Gillman, P. K. Tricyclic antidepressant pharmacology and therapeutic drug interactions updated. Br. J. Pharmacol. 151 , 737–748 (2007).

Taylor, C., Fricker, A. D., Devi, L. A. & Gomes, I. Mechanisms of action of antidepressants: from neurotransmitter systems to signaling pathways. Cell Signal. 17 , 549–557 (2005).

Jann, M. W. & Slade, J. H. Antidepressant agents for the treatment of chronic pain and depression. Pharmacotherapy 27 , 1571–1587 (2007).

Shultz, E. & Malone, D. A. Jr A practical approach to prescribing antidepressants. Cleve Clin. J. Med. 80 , 625–631 (2013).

Croom, K. F., Perry, C. M. & Plosker, G. L. Mirtazapine: a review of its use in major depression and other psychiatric disorders. CNS Drugs 23 , 427–452 (2009).

Benjamin, S. & Doraiswamy, P. M. Review of the use of mirtazapine in the treatment of depression. Expert Opin. Pharmacother. 12 , 1623–1632 (2011).

Cleare, A. et al. Evidence-based guidelines for treating depressive disorders with antidepressants: a revision of the 2008 British Association for Psychopharmacology guidelines. J. Psychopharmacol. 29 , 459–525 (2015).

Guloglu, C., Orak, M., Ustundag, M. & Altunci, Y. A. Analysis of amitriptyline overdose in emergency medicine. Emerg. Med. J. 28 , 296–299 (2011).

David, D. J. & Gourion, D. [Antidepressant and tolerance: determinants and management of major side effects]. Encephale 42 , 553–561 (2016).

Richelson, E. Antimuscarinic and other receptor-blocking properties of antidepressants. Mayo Clin. Proc. 58 , 40–46 (1983).

Hisaoka, K. et al. Tricyclic antidepressant amitriptyline activates fibroblast growth factor receptor signaling in glial cells: involvement in glial cell line-derived neurotrophic factor production. J. Biol. Chem. 286 , 21118–21128 (2011).

Morioka, N. et al. Amitriptyline up-regulates connexin43-gap junction in rat cultured cortical astrocytes via activation of the p38 and c-Fos/AP-1 signalling pathway. Br. J. Pharmacol. 171 , 2854–2867 (2014).

Budzinski, M. L. et al. Tricyclic antidepressants target FKBP51 SUMOylation to restore glucocorticoid receptor activity. Mol. Psychiatry 27 , 2533–2545 (2022).

Malison, R. T. et al. Reduced brain serotonin transporter availability in major depression as measured by [123I]-2 beta-carbomethoxy-3 beta-(4-iodophenyl)tropane and single photon emission computed tomography. Biol. Psychiatry 44 , 1090–1098 (1998).

Samuels, B. A. et al. 5-HT1A receptors on mature dentate gyrus granule cells are critical for the antidepressant response. Nat. Neurosci. 18 , 1606–1616 (2015).

Scorza, M. C. et al. Preclinical and clinical characterization of the selective 5-HT(1A) receptor antagonist DU-125530 for antidepressant treatment. Br. J. Pharmacol. 167 , 1021–1034 (2012).

Cremers, T. I. et al. Inactivation of 5-HT(2C) receptors potentiates consequences of serotonin reuptake blockade. Neuropsychopharmacology 29 , 1782–1789 (2004).

Boothman, L. J., Mitchell, S. N. & Sharp, T. Investigation of the SSRI augmentation properties of 5-HT(2) receptor antagonists using in vivo microdialysis. Neuropharmacology 50 , 726–732 (2006).

Haddjeri, N., de Montigny, C. & Blier, P. Modulation of the firing activity of noradrenergic neurones in the rat locus coeruleus by the 5-hydroxtryptamine system. Br. J. Pharmacol. 120 , 865–875 (1997).

Szabo, S. T., de Montigny, C. & Blier, P. Modulation of noradrenergic neuronal firing by selective serotonin reuptake blockers. Br. J. Pharmacol. 126 , 568–571 (1999).

Jang, S. W. et al. Amitriptyline is a TrkA and TrkB receptor agonist that promotes TrkA/TrkB heterodimerization and has potent neurotrophic activity. Chem. Biol. 16 , 644–656 (2009).

Casarotto, P. C. et al. Antidepressant drugs act by directly binding to TRKB neurotrophin receptors. Cell 184 , 1299–1313.e1219 (2021).

Li, B. et al. Down-regulation of GluK2 kainate receptor expression by chronic treatment with mood-stabilizing anti-convulsants or lithium in cultured astrocytes and brain, but not in neurons. Neuropharmacology 57 , 375–385 (2009).

Diaz, S. L., Narboux-Neme, N., Boutourlinsky, K., Doly, S. & Maroteaux, L. Mice lacking the serotonin 5-HT2B receptor as an animal model of resistance to selective serotonin reuptake inhibitors antidepressants. Eur. Neuropsychopharmacol. 26 , 265–279 (2016).

Sviridova, A. et al. The role of 5-HT(2B)-receptors in fluoxetine-mediated modulation of Th17- and Th1-cells in multiple sclerosis. J. Neuroimmunol. 356 , 577608 (2021).

Hertz, L. Isotope-based quantitation of uptake, release, and metabolism of glutamate and glucose in cultured astrocytes. Methods Mol. Biol. 814 , 305–323 (2012).

Arakawa, R. et al. Venlafaxine ER blocks the norepinephrine transporter in the brain of patients with major depressive disorder: a PET study using [18F]FMeNER-D2. Int J. Neuropsychopharmacol. 22 , 278–285 (2019).

Gould, G. G., Javors, M. A. & Frazer, A. Effect of chronic administration of duloxetine on serotonin and norepinephrine transporter binding sites in rat brain. Biol. Psychiatry 61 , 210–215 (2007).

Owens, M. J. et al. Estimates of serotonin and norepinephrine transporter inhibition in depressed patients treated with paroxetine or venlafaxine. Neuropsychopharmacology 33 , 3201–3212 (2008).

Sramek, J. J. et al. Exploratory biomarker study of the triple reuptake inhibitor sep-432 compared to the dual reuptake inhibitor duloxetine in healthy normal subjects. CNS Neurosci. Ther. 22 , 404–412 (2016).

Wang, Y. et al. The association between antidepressant treatment and brain connectivity in two double-blind, placebo-controlled clinical trials: a treatment mechanism study. Lancet Psychiatry 6 , 667–674 (2019).

Berman, R. M. et al. Antidepressant effects of ketamine in depressed patients. Biol. Psychiatry 47 , 351–354 (2000).

Murrough, J. W. et al. Antidepressant efficacy of ketamine in treatment-resistant major depression: a two-site randomized controlled trial. Am. J. Psychiatry 170 , 1134–1142 (2013).

Zanos, P. et al. NMDAR inhibition-independent antidepressant actions of ketamine metabolites. Nature 533 , 481–486 (2016).

Li, N. et al. mTOR-dependent synapse formation underlies the rapid antidepressant effects of NMDA antagonists. Science 329 , 959–964 (2010).

Li, N. et al. Glutamate N-methyl-D-aspartate receptor antagonists rapidly reverse behavioral and synaptic deficits caused by chronic stress exposure. Biol. Psychiatry 69 , 754–761 (2011).

Beurel, E., Grieco, S. F., Amadei, C., Downey, K. & Jope, R. S. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor signaling. Bipolar Disord. 18 , 473–480 (2016).

Miller, O. H., Moran, J. T. & Hall, B. J. Two cellular hypotheses explaining the initiation of ketamine’s antidepressant actions: direct inhibition and disinhibition. Neuropharmacology 100 , 17–26 (2016).

Mingardi, J. et al. miR-9-5p is involved in the rescue of stress-dependent dendritic shortening of hippocampal pyramidal neurons induced by acute antidepressant treatment with ketamine. Neurobiol. Stress 15 , 100381 (2021).

Krystal, J. H., Charney, D. S. & Duman, R. S. A new rapid-acting antidepressant. Cell 181 , 7 (2020).

Moliner, R. et al. Psychedelics promote plasticity by directly binding to BDNF receptor TrkB. Nat. Neurosci. 26 , 1032–1041 (2023).

Halberstadt, A. L., Koedood, L., Powell, S. B. & Geyer, M. A. Differential contributions of serotonin receptors to the behavioral effects of indoleamine hallucinogens in mice. J. Psychopharmacol. 25 , 1548–1561 (2011).

Hesselgrave, N., Troppoli, T. A., Wulff, A. B., Cole, A. B. & Thompson, S. M. Harnessing psilocybin: antidepressant-like behavioral and synaptic actions of psilocybin are independent of 5-HT2R activation in mice. Proc. Natl Acad. Sci. USA 118 , e2022489118 (2021).

Cao, D. et al. Structure-based discovery of nonhallucinogenic psychedelic analogs. Science 375 , 403–411 (2022).

Shao, L. X. et al. Psilocybin induces rapid and persistent growth of dendritic spines in frontal cortex in vivo. Neuron 109 , 2535–2544 e2534 (2021).

Caraci, F. et al. Neurobiological links between depression and AD: The role of TGF-beta1 signaling as a new pharmacological target. Pharmacol. Res 130 , 374–384 (2018).

Chen, B., Wang, J. F., Sun, X. & Young, L. T. Regulation of GAP-43 expression by chronic desipramine treatment in rat cultured hippocampal cells. Biol. Psychiatry 53 , 530–537 (2003).

Lee, K. M. & Kim, Y. K. The role of IL-12 and TGF-beta1 in the pathophysiology of major depressive disorder. Int. Immunopharmacol. 6 , 1298–1304 (2006).

Sutcigil, L. et al. Pro- and anti-inflammatory cytokine balance in major depression: effect of sertraline therapy. Clin. Dev. Immunol. 2007 , 76396 (2007).

Zhao, Y. N. et al. Nelumbo nucifera gaertn stems (Hegeng) improved depression Behavior in CUMS mice by regulating NCAM and GAP-43 expression. Evid. Based Complement Altern. Med 2020 , 3056954 (2020).

Zavvari, F., Nahavandi, A. & Goudarzi, M. Fluoxetine attenuates stress-induced depressive-like behavior through modulation of hippocampal GAP43 and neurogenesis in male rats. J. Chem. Neuroanat. 103 , 101711 (2020).

Wang, Q., Timberlake, M. A. 2nd, Prall, K. & Dwivedi, Y. The recent progress in animal models of depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 77 , 99–109 (2017).

Aten, S. et al. Chronic stress impairs the structure and function of astrocyte networks in an animal model of depression. Neurochem. Res. 48 , 1191–1210 (2023).

Liang, S. et al. Iron aggravates the depressive phenotype of stressed mice by compromising the glymphatic system. Neurosci. Bull. 36 , 1542–1546 (2020).

Antoniuk, S., Bijata, M., Ponimaskin, E. & Wlodarczyk, J. Chronic unpredictable mild stress for modeling depression in rodents: meta-analysis of model reliability. Neurosci. Biobehav Rev. 99 , 101–116 (2019).

Fernandez, D. C. et al. Light affects mood and learning through distinct retina-brain pathways. Cell 175 , 71–84.e18 (2018).

Smolders, K. C., de Kort, Y. A. & Cluitmans, P. J. A higher illuminance induces alertness even during office hours: findings on subjective measures, task performance and heart rate measures. Physiol. Behav. 107 , 7–16 (2012).

Liu, A. et al. Encoding of environmental illumination by primate melanopsin neurons. Science 379 , 376–381 (2023).

Lam, R. W. et al. Efficacy of bright light treatment, fluoxetine, and the combination in patients with nonseasonal major depressive disorder: a randomized clinical trial. JAMA Psychiatry 73 , 56–63 (2016).

Rutten, S. et al. Bright light therapy for depression in Parkinson disease: a randomized controlled trial. Neurology 92 , e1145–e1156 (2019).

Li, V. W. et al. Functional outcomes with bright light in monotherapy and combined with fluoxetine in patients with major depressive disorder: results from the LIFE-D trial. J. Affect. Disord. 297 , 396–400 (2022).

Guzel Ozdemir, P. et al. Comparison of venlafaxine alone versus venlafaxine plus bright light therapy combination for severe major depressive disorder. J. Clin. Psychiatry 76 , e645–654 (2015).

Lambert, G. W., Reid, C., Kaye, D. M., Jennings, G. L. & Esler, M. D. Effect of sunlight and season on serotonin turnover in the brain. Lancet 360 , 1840–1842 (2002).

Huang, L. et al. A visual circuit related to habenula underlies the antidepressive effects of light therapy. Neuron 102 , 128–142.e128 (2019).

McClintock, S. M. et al. Consensus recommendations for the clinical application of repetitive transcranial magnetic stimulation (rTMS) in the treatment of depression. J. Clin. Psychiatry 79 , 16cs10905 (2018).

Wall, C. A. et al. Adjunctive use of repetitive transcranial magnetic stimulation in depressed adolescents: a prospective, open pilot study. J. Clin. Psychiatry 72 , 1263–1269 (2011).

Qiu, H. et al. Efficacy and safety of repetitive transcranial magnetic stimulation in children and adolescents with depression: a systematic review and preliminary meta-analysis. J. Affect. Disord. 320 , 305–312 (2023).

Mutz, J. et al. Comparative efficacy and acceptability of non-surgical brain stimulation for the acute treatment of major depressive episodes in adults: systematic review and network meta-analysis. BMJ 364 , l1079 (2019).

Faller, J. et al. Daily prefrontal closed-loop repetitive transcranial magnetic stimulation (rTMS) produces progressive EEG quasi-alpha phase entrainment in depressed adults. Brain Stimul. 15 , 458–471 (2022).

Kaster, T. S. et al. Efficacy, tolerability, and cognitive effects of deep transcranial magnetic stimulation for late-life depression: a prospective randomized controlled trial. Neuropsychopharmacology 43 , 2231–2238 (2018).

Desbeaumes Jodoin, V., Miron, J. P. & Lesperance, P. Safety and efficacy of accelerated repetitive transcranial magnetic stimulation protocol in elderly depressed unipolar and bipolar patients. Am. J. Geriatr. Psychiatry 27 , 548–558 (2019).

Wathra, R. A. et al. Effect of prior pharmacotherapy on remission with sequential bilateral theta-burst versus standard bilateral repetitive transcranial magnetic stimulation in treatment-resistant late-life depression. Br. J. Psychiatry 223 , 504–506 (2023).

Cox, E. Q. et al. Repetitive transcranial magnetic stimulation for the treatment of postpartum depression. J. Affect. Disord. 264 , 193–200 (2020).

Pascual-Leone, A., Rubio, B., Pallardo, F. & Catala, M. D. Rapid-rate transcranial magnetic stimulation of left dorsolateral prefrontal cortex in drug-resistant depression. Lancet 348 , 233–237 (1996).

Zrenner, B. et al. Brain oscillation-synchronized stimulation of the left dorsolateral prefrontal cortex in depression using real-time EEG-triggered TMS. Brain Stimul. 13 , 197–205 (2020).

Fitzgerald, P. B. Targeting repetitive transcranial magnetic stimulation in depression: do we really know what we are stimulating and how best to do it? Brain Stimul. 14 , 730–736 (2021).

Rosen, A. C. et al. Targeting location relates to treatment response in active but not sham rTMS stimulation. Brain Stimul. 14 , 703–709 (2021).

Moffitt, T. E. et al. How common are common mental disorders? Evidence that lifetime prevalence rates are doubled by prospective versus retrospective ascertainment. Psychol. Med. 40 , 899–909 (2010).

Brini, S. et al. Efficacy and safety of transcranial magnetic stimulation for treating major depressive disorder: An umbrella review and re-analysis of published meta-analyses of randomised controlled trials. Clin. Psychol. Rev. 100 , 102236 (2023).

Qaseem, A., Barry, M. J. & Kansagara, D. Clinical Guidelines Committee of the American College of PhysiciansNonpharmacologic versus pharmacologic treatment of adult patients with major depressive disorder: a clinical practice guideline from the american college of physicians. Ann. Intern. Med. 164 , 350–359 (2016).

Biesheuvel-Leliefeld, K. E. et al. Effectiveness of psychological interventions in preventing recurrence of depressive disorder: meta-analysis and meta-regression. J. Affect. Disord. 174 , 400–410 (2015).

Breedvelt, J. J. F. et al. Psychological interventions as an alternative and add-on to antidepressant medication to prevent depressive relapse: systematic review and meta-analysis. Br. J. Psychiatry 219 , 538–545 (2021).

Guidi, J. & Fava, G. A. Sequential combination of pharmacotherapy and psychotherapy in major depressive disorder: a systematic review and meta-analysis. JAMA Psychiatry 78 , 261–269 (2021).

Tang, Y., Yin, H. Y., Rubini, P., Illes, P. & Acupuncture-Induced Analgesia: a neurobiological basis in purinergic signaling. Neuroscientist 22 , 563–578 (2016).

Chan, Y. Y., Lo, W. Y., Yang, S. N., Chen, Y. H. & Lin, J. G. The benefit of combined acupuncture and antidepressant medication for depression: a systematic review and meta-analysis. J. Affect Disord. 176 , 106–117 (2015).

Mischoulon, D., Brill, C. D., Ameral, V. E., Fava, M. & Yeung, A. S. A pilot study of acupuncture monotherapy in patients with major depressive disorder. J. Affect Disord. 141 , 469–473 (2012).

Yue, N. et al. Electro-acupuncture alleviates chronic unpredictable stress-induced depressive- and anxiety-like behavior and hippocampal neuroinflammation in rat model of depression. Front. Mol. Neurosci. 11 , 149 (2018).

Jung, J. et al. Lipidomics reveals that acupuncture modulates the lipid metabolism and inflammatory interaction in a mouse model of depression. Brain Behav. Immun. 94 , 424–436 (2021).

Lin, S. S. et al. Electroacupuncture prevents astrocyte atrophy to alleviate depression. Cell Death Dis. 14 , 343 (2023).

Wang, Z. et al. Acupuncture treatment modulates the corticostriatal reward circuitry in major depressive disorder. J. Psychiatr. Res. 84 , 18–26 (2017).

Duan, D. M., Tu, Y., Liu, P. & Jiao, S. Antidepressant effect of electroacupuncture regulates signal targeting in the brain and increases brain-derived neurotrophic factor levels. Neural Regen. Res. 11 , 1595–1602 (2016).

Bai, L. et al. Mechanisms underlying the antidepressant effect of acupuncture via the CaMK signaling pathway. Front Behav. Neurosci. 14 , 563698 (2020).

Cai, X. et al. Electroacupuncture alleviated depression-like behaviors in ventromedial prefrontal cortex of chronic unpredictable mild stress-induced rats: Increasing synaptic transmission and phosphorylating dopamine transporter. CNS Neurosci. Ther. 29 , 2608–2620 (2023).

Xu, G. et al. Clinical evidence for association of acupuncture with improved major depressive disorder: a systematic review and meta-analysis of randomized control trials. Neuropsychobiology 82 , 1–13 (2023).

Ding, Y. et al. Molecular and genetic characterization of depression: overlap with other psychiatric disorders and aging. Mol. Neuropsychiatry 1 , 1–12 (2015).

PubMed   PubMed Central   Google Scholar  

Kay, R. B. & Brunjes, P. C. Diversity among principal and GABAergic neurons of the anterior olfactory nucleus. Front. Cell. Neurosci. 8 , 111 (2014).

Karolewicz, B. et al. Reduced level of glutamic acid decarboxylase-67 kDa in the prefrontal cortex in major depression. Int. J. Neuropsychopharmacol. 13 , 411–420 (2010).

Azmitia, E. C. Serotonin neurons, neuroplasticity, and homeostasis of neural tissue. Neuropsychopharmacology 21 , 33S–45S (1999).

Kerman, I. A. et al. Evidence for transcriptional factor dysregulation in the dorsal raphe nucleus of patients with major depressive disorder. Front. Neurosci. 6 , 135 (2012).

Keller-Wood, M. Hypothalamic-pituitary–adrenal axis-feedback control. Compr. Physiol. 5 , 1161–1182 (2015).

Alt, S. R. et al. Differential expression of glucocorticoid receptor transcripts in major depressive disorder is not epigenetically programmed. Psychoneuroendocrinology 35 , 544–556 (2010).

van Loo, H. M., Aggen, S. H., Gardner, C. O. & Kendler, K. S. Sex similarities and differences in risk factors for recurrence of major depression. Psychol. Med. 48 , 1685–1693 (2018).

Salk, R. H., Hyde, J. S. & Abramson, L. Y. Gender differences in depression in representative national samples: meta-analyses of diagnoses and symptoms. Psychol. Bull. 143 , 783–822 (2017).

Cavanagh, A., Wilson, C. J., Kavanagh, D. J. & Caputi, P. Differences in the expression of symptoms in men versus women with depression: a systematic review and meta-analysis. Harv. Rev. Psychiatry 25 , 29–38 (2017).

Marcus, S. M. et al. Gender differences in depression: findings from the STAR*D study. J. Affect Disord. 87 , 141–150 (2005).

Poulter, M. O. et al. GABAA receptor promoter hypermethylation in suicide brain: implications for the involvement of epigenetic processes. Biol. Psychiatry 64 , 645–652 (2008).

Seney, M. L. et al. The role of genetic sex in affect regulation and expression of GABA-related genes across species. Front. Psychiatry 4 , 104 (2013).

Gray, A. L., Hyde, T. M., Deep-Soboslay, A., Kleinman, J. E. & Sodhi, M. S. Sex differences in glutamate receptor gene expression in major depression and suicide. Mol. Psychiatry 20 , 1057–1068 (2015).

Goswami, D. B., May, W. L., Stockmeier, C. A. & Austin, M. C. Transcriptional expression of serotonergic regulators in laser-captured microdissected dorsal raphe neurons of subjects with major depressive disorder: sex-specific differences. J. Neurochem. 112 , 397–409 (2010).

Szewczyk, B. et al. Gender-specific decrease in NUDR and 5-HT1A receptor proteins in the prefrontal cortex of subjects with major depressive disorder. Int. J. Neuropsychopharmacol. 12 , 155–168 (2009).

Fiori, L. M. et al. miR-323a regulates ERBB4 and is involved in depression. Mol. Psychiatry 26 , 4191–4204 (2021).

Roy, B., Wang, Q., Palkovits, M., Faludi, G. & Dwivedi, Y. Altered miRNA expression network in locus coeruleus of depressed suicide subjects. Sci. Rep. 7 , 4387 (2017).

Zheng, P. et al. Identification of sex-specific urinary biomarkers for major depressive disorder by combined application of NMR- and GC-MS-based metabonomics. Transl. Psychiatry 6 , e955 (2016).

Liu, X. et al. Discovery and validation of plasma biomarkers for major depressive disorder classification based on liquid chromatography-mass spectrometry. J. Proteome Res. 14 , 2322–2330 (2015).

Liu, X. et al. Plasma lipidomics reveals potential lipid markers of major depressive disorder. Anal. Bioanal. Chem. 408 , 6497–6507 (2016).

Wang, Z., Gerstein, M. & Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat. Rev. Genet 10 , 57–63 (2009).

Xu, Y. et al. Serum cytokines-based biomarkers in the diagnosis and monitoring of therapeutic response in patients with major depressive disorder. Int. Immunopharmacol. 118 , 110108 (2023).

Pantazatos, S. P. et al. Whole-transcriptome brain expression and exon-usage profiling in major depression and suicide: evidence for altered glial, endothelial and ATPase activity. Mol. Psychiatry 22 , 760–773 (2017).

Herbet, M. et al. Altered expression of genes involved in brain energy metabolism as adaptive responses in rats exposed to chronic variable stress; changes in cortical level of glucogenic and neuroactive amino acids. Mol. Med. Rep. 19 , 2386–2396 (2019).

Yamanishi, K. et al. Analysis of genes linked to depressive-like behaviors in interleukin-18-deficient mice: gene expression profiles in the brain. Biomed. Rep. 12 , 3–10 (2020).

Kuperman, Y. et al. Perifornical Urocortin-3 mediates the link between stress-induced anxiety and energy homeostasis. Proc. Natl Acad. Sci. USA 107 , 8393–8398 (2010).

Bustamante, A. C., Armstrong, D. L. & Uddin, M. Epigenetic profiles associated with major depression in the human brain. Psychiatry Res. 260 , 439–442 (2018).

Beger, R. D. et al. Metabolomics enables precision medicine: “A White Paper, Community Perspective”. Metabolomics 12 , 149 (2016).

Kaddurah-Daouk, R. et al. Cerebrospinal fluid metabolome in mood disorders-remission state has a unique metabolic profile. Sci. Rep. 2 , 667 (2012).

Schmaal, L. et al. Cortical abnormalities in adults and adolescents with major depression based on brain scans from 20 cohorts worldwide in the ENIGMA Major Depressive Disorder Working Group. Mol. Psychiatry 22 , 900–909 (2017).

Schmitgen, M. M. et al. Aberrant cortical neurodevelopment in major depressive disorder. J. Affect. Disord. 243 , 340–347 (2019).

Chen, Z. et al. High-field magnetic resonance imaging of structural alterations in first-episode, drug-naive patients with major depressive disorder. Transl. Psychiatry 6 , e942 (2016).

Grimm, S. et al. Increased self-focus in major depressive disorder is related to neural abnormalities in subcortical-cortical midline structures. Hum. Brain Mapp. 30 , 2617–2627 (2009).

Yoshimura, S. et al. Cognitive behavioral therapy for depression changes medial prefrontal and ventral anterior cingulate cortex activity associated with self-referential processing. Soc. Cogn. Affect. Neurosci. 9 , 487–493 (2014).

Yu, H. et al. Functional brain abnormalities in major depressive disorder using the Hilbert-Huang transform. Brain Imaging Behav. 12 , 1556–1568 (2018).

Holmes, S. E. et al. Lower synaptic density is associated with depression severity and network alterations. Nat. Commun. 10 , 1529 (2019).

Bettini, E. et al. Pharmacological comparative characterization of REL-1017 (Esmethadone-HCl) and Other NMDAR channel blockers in human heterodimeric N-methyl-D-aspartate receptors. Pharmaceuticals (Basel) 15 , 997 (2022).

Hanania, T., Manfredi, P., Inturrisi, C. & Vitolo, O. V. The N-methyl-D-aspartate receptor antagonist d-methadone acutely improves depressive-like behavior in the forced swim test performance of rats. Exp. Clin. Psychopharmacol. 28 , 196–201 (2020).

Fogaca, M. V. et al. N-Methyl-D-aspartate receptor antagonist d-methadone produces rapid, mTORC1-dependent antidepressant effects. Neuropsychopharmacology 44 , 2230–2238 (2019).

Fava, M. et al. REL-1017 (esmethadone) as adjunctive treatment in patients with major depressive disorder: a phase 2a randomized double-blind trial. Am. J. Psychiatry 179 , 122–131 (2022).

De Martin, S. et al. REL-1017 (Esmethadone) increases circulating BDNF levels in healthy subjects of a phase 1 clinical study. Front. Pharmacol. 12 , 671859 (2021).

Chou, T. H., Kang, H., Simorowski, N., Traynelis, S. F. & Furukawa, H. Structural insights into assembly and function of GluN1-2C, GluN1-2A-2C, and GluN1-2D NMDARs. Mol. Cell 82 , 4548–4563.e4544 (2022).

Hochschild, A. et al. Ketamine vs midazolam: Mood improvement reduces suicidal ideation in depression. J. Affect Disord. 300 , 10–16 (2022).

Burgdorf, J. et al. GLYX-13, a NMDA receptor glycine-site functional partial agonist, induces antidepressant-like effects without ketamine-like side effects. Neuropsychopharmacology 38 , 729–742 (2013).

Gigliucci, V. et al. Ketamine elicits sustained antidepressant-like activity via a serotonin-dependent mechanism. Psychopharmacology (Berl.) 228 , 157–166 (2013).

Daly, E. J. et al. Efficacy and safety of intranasal esketamine adjunctive to oral antidepressant therapy in treatment-resistant depression: a randomized clinical trial. JAMA Psychiatry 75 , 139–148 (2018).

Zhao, J. et al. Low-dose ketamine inhibits neuronal apoptosis and neuroinflammation in PC12 cells via alpha7nAChR mediated TLR4/MAPK/NF-kappaB signaling pathway. Int. Immunopharmacol. 117 , 109880 (2023).

Yang, Y. et al. Ketamine relieves depression-like behaviors induced by chronic postsurgical pain in rats through anti-inflammatory, anti-oxidant effects and regulating BDNF expression. Psychopharmacology (Berl.) 237 , 1657–1669 (2020).

Shibakawa, Y. S. et al. Effects of ketamine and propofol on inflammatory responses of primary glial cell cultures stimulated with lipopolysaccharide. Br. J. Anaesth. 95 , 803–810 (2005).

Abbasi, S., Hosseini, F., Modabbernia, A., Ashrafi, M. & Akhondzadeh, S. Effect of celecoxib add-on treatment on symptoms and serum IL-6 concentrations in patients with major depressive disorder: randomized double-blind placebo-controlled study. J. Affect. Disord. 141 , 308–314 (2012).

Akhondzadeh, S. et al. Clinical trial of adjunctive celecoxib treatment in patients with major depression: a double blind and placebo controlled trial. Depress Anxiety 26 , 607–611 (2009).

Nettis, M. A. et al. Augmentation therapy with minocycline in treatment-resistant depression patients with low-grade peripheral inflammation: results from a double-blind randomised clinical trial. Neuropsychopharmacology 46 , 939–948 (2021).

Hasebe, K. et al. Exploring interleukin-6, lipopolysaccharide-binding protein and brain-derived neurotrophic factor following 12 weeks of adjunctive minocycline treatment for depression. Acta Neuropsychiatr. 34 , 220–227 (2022).

Su, K. et al. Omega-3 fatty acids in the prevention of interferon-alpha-induced depression: results from arandomized, controlled trial. Biol. Psychiatry 76 , 559–566 (2014).

Berk, M. et al. Youth Depression Alleviation with Anti-inflammatory Agents (YoDA-A): a randomised clinical trial of rosuvastatin and aspirin. BMC Med . 18 , 16 (2020).

Meltzer-Brody, S. et al. Brexanolone injection in post-partum depression: two multicentre, double-blind, randomised, placebo-controlled, phase 3 trials. Lancet 392 , 1058–1070 (2018).

Leal, G. C. et al. Arketamine as adjunctive therapy for treatment-resistant depression: A placebo-controlled pilot study. J Affect. Disord. 330 , 7–15 (2023).

Kuga, N., Sasaki, T., Takahara, Y., Matsuki, N. & Ikegaya, Y. Large-scale calcium waves traveling through astrocytic networks in vivo. J. Neurosci. 31 , 2607–2614 (2011).

Shawcross, D. L. et al. Infection and systemic inflammation, not ammonia, are associated with Grade 3/4 hepatic encephalopathy, but not mortality in cirrhosis. J. Hepatol. 54 , 640–649 (2011).

Page, G. et al. The up-regulation of the striatal dopamine transporter’s activity by cAMP is PKA-, CaMK II- and phosphatase-dependent. Neurochem. Int. 45 , 627–632 (2004).

França, A. S. et al. D2 dopamine receptor regulation of learning, sleep and plasticity. Eur. Neuropsychopharmacol. 25 , 493–504 (2015).

Beaulieu, J. M. & Gainetdinov, R. R. The physiology, signaling, and pharmacology of dopamine receptors. Pharmacol. Rev. 63 , 182–217 (2011).

Opal, M. D. et al. Serotonin 2C receptor antagonists induce fast-onset antidepressant effects. Mol. Psychiatry 19 , 1106–1114 (2014).

Seki, K., Yoshida, S. & Jaiswal, M. K. Molecular mechanism of noradrenaline during the stress-induced major depressive disorder. Neural Regen. Res. 13 , 1159–1169 (2018).

Duman, R. S., Aghajanian, G. K., Sanacora, G. & Krystal, J. H. Synaptic plasticity and depression: new insights from stress and rapid-acting antidepressants. Nat. Med. 22 , 238–249 (2016).

Yang, B. et al. Comparison of R-ketamine and rapastinel antidepressant effects in the social defeat stress model of depression. Psychopharmacology 233 , 3647–3657 (2016).

Download references

Acknowledgements

This work was supported by the National Natural Science Foundation of China, MX [grant number 32271038] and BL [grant number 81871852]; Shenyang Science and Technology Innovation Talents Project, BL [grant number RC210251]; ‘ChunHui’ Program of Education Ministry, BL [grant number 2020703]; National Natural Science Foundation of China-Russian Science Foundation (NSFC-RSF), YT [grant number 82261138557]; Sichuan Provincial Administration of Traditional Chinese Medicine, YT [grant number 2023zd024].

Author information

Authors and affiliations.

Department of Forensic Analytical Toxicology, School of Forensic Medicine, China Medical University, Shenyang, China

Lulu Cui, Shu Li, Siman Wang, Xiafang Wu, Yingyu Liu, Weiyang Yu, Yijun Wang & Baoman Li

Liaoning Province Key Laboratory of Forensic Bio-evidence Sciences, Shenyang, China

China Medical University Centre of Forensic Investigation, Shenyang, China

International Joint Research Centre on Purinergic Signalling/Key Laboratory of Acupuncture for Senile Disease (Chengdu University of TCM), Ministry of Education/School of Health and Rehabilitation, Chengdu University of Traditional Chinese Medicine/Acupuncture and Chronobiology Key Laboratory of Sichuan Province, Chengdu, China

Department of Orthopaedics, The First Hospital, China Medical University, Shenyang, China

Maosheng Xia

You can also search for this author in PubMed   Google Scholar

Contributions

L.C., X.W., and B.L. provided direction and guidance throughout the preparation of this manuscript. L.C., X.W., and B.L. wrote and edited the manuscript. L.C., S.L., S.W., M.X., and B.L. reviewed and made significant revisions to the manuscript. L.C., S.L., S.W., X.W., Y.L., W.Y., Y.W., Y.T., M.X., and B.L. collected and prepared the related papers. All authors have read and approved the article.

Corresponding authors

Correspondence to Maosheng Xia or Baoman Li .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Cui, L., Li, S., Wang, S. et al. Major depressive disorder: hypothesis, mechanism, prevention and treatment. Sig Transduct Target Ther 9 , 30 (2024). https://doi.org/10.1038/s41392-024-01738-y

Download citation

Received : 20 September 2023

Revised : 24 December 2023

Accepted : 28 December 2023

Published : 09 February 2024

DOI : https://doi.org/10.1038/s41392-024-01738-y

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

This article is cited by

Association between depression and infertility risk among american women aged 18–45 years: the mediating effect of the nhhr.

• QiaoRui Yang
• ZhenLiang Fan

Lipids in Health and Disease (2024)

ProMENDA: an updated resource for proteomic and metabolomic characterization in depression

Translational Psychiatry (2024)

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Singapore Med J
• v.57(11); 2016 Nov

Major depression in primary care: making the diagnosis

Chung wai mark ng.

1 SingHealth Polyclinics, Changi General Hospital, Singapore

Choon How How

2 Care and Health Integration, Changi General Hospital, Singapore

Yin Ping Ng

3 Penang Medical College, Penang, Malaysia

4 Penang Adventist Hospital, Penang, Malaysia

Associated Data

Major depression is a common condition seen in the primary care setting, often presenting with somatic symptoms. It is potentially a chronic illness with considerable morbidity, and a high rate of relapse and recurrence. Major depression has a bidirectional relationship with chronic diseases, and a strong association with increased age and coexisting mental illnesses (e.g. anxiety disorders). Screening can be performed using clinical tools for major depression, such as the Patient Health Questionaire-2, Patient Health Questionaire-9 and Beck Depression Inventory, so that timely treatment can be initiated. An accurate diagnosis of major depression and its severity is essential for prompt treatment to reduce morbidity and mortality. This is the first of a series of articles that illustrates the approach to the management of major depression in primary care. Our next articles will cover suicide risk assessment in a depressed patient and outline the basic principles of management and treatment modalities.

Susan came to your clinic with her grandson Sam for an unscheduled consultation two months ahead of her next chronic diseases review. Susan kept looking down and heaving sighs now and then. Sam reported that his grandmother had not been herself since her close cousin passed away two months ago, and that she had since stopped knitting and following Korean drama serials. Her sleep and appetite had also been affected in the last month. His family had asked Sam to take his grandmother for an assessment .

WHAT IS MAJOR DEPRESSION?

Major depression is a mood disorder that presents with either a persistent feeling of sadness or loss of pleasure, or both.( 1 )

HOW COMMON IS THIS IN MY PRACTICE?

The Singapore Mental Health Study (SMHS) 2010 reported that major depression was the most common mental illness with a lifetime prevalence of 5.8%, followed by alcohol abuse and obsessive compulsive disorder.( 2 ) However, only 18% of patients with mental disorders sought help from primary care practitioners.( 2 ) The risk of major depression is significantly higher in the older population.( 3 ) As such, primary care doctors need to be familiar with the diagnosis and management of major depression.

WHAT CAN I DO IN MY PRACTICE?

Screening – particularly in patients at risk.

Major depression is a chronic illness of considerable morbidity, with high rates of relapse and recurrence;( 4 , 5 ) however, many patients suffering from major depression do not seek help early.( 2 , 6 ) This could be due to various factors: lack of insight into their medical condition; the stigma associated with the label of mental illness; and financial factors.( 6 ) The SMHS found that the median time between the onset of illness and help-seeking was five years.( 2 ) Hence, viewing screening as the first step, followed by diagnosis, early treatment and follow-up, was shown to result in better outcomes.( 7 , 8 )

There are many good recommendations that advocate screening for major depression. The clinical practice guidelines on major depression published by the Ministry of Health, Singapore, in 2012 recommend screening for major depression in high-risk persons where the benefits outweigh the risks.( 9 ) The United States Preventive Services Task Force recommends screening for major depression in the general adult population and having adequate systems in place to ensure proper diagnosis, treatment and follow-up.( 10 ) While the Canadian Task Force on Preventive Healthcare does not recommend routine screening of adults in primary care, it advocates vigilance for major depression in patients with risk factors and symptoms of insomnia, low mood, anhedonia and suicidal thoughts.( 11 ) The 2016 updated guidelines from the National Institute for Health and Care Excellence, United Kingdom, recommend that clinicians screen for major depression in persons who have chronic medical conditions with impaired function, as well as persons with a past history of major depression, by asking if low mood, hopelessness and anhedonia are also present.( 12 )

Which patients are at greater risk of major depression?

Anyone with a past depressive episode is at risk of further episodes, as the natural course of major depression involves frequent relapses.( 5 ) There is a bidirectional relationship between major depression and chronic disease. The SMHS showed that almost half of the persons with major depression had at least one chronic physical condition.( 2 ) Similarly, individuals with chronic physical conditions are known to be at greater risk of major depression.( 13 - 15 ) For example, the prevalence of major depression is higher in persons with chronic medical conditions such as heart disease, stroke and diabetes mellitus;( 16 , 17 ) coexisting major depression is associated with poorer prognosis and an increased rate of complications that are related to these conditions.( 18 ) A significant association was found between major depression and a number of diabetic complications. Those who were depressed were also more likely to die after a heart attack compared to non-depressed patients.( 19 )

Apart from the usual symptoms of major depression such as insomnia and low energy level, patients often present to primary care doctors with somatic symptoms.( 20 , 21 ) Physical symptoms associated with major depression include backaches, nonspecific musculoskeletal complaints, having multiple (three or more) somatic complaints, and having vague complaints.( 22 ) Patients may experience deteriorating memory as well. A review has shown that major depression is associated with attention deficit and poor cognitive functioning, particularly when the patient is acutely depressed.( 23 ) The elderly, in particular, are less likely to report low mood, instead presenting with physical complaints and deterioration in cognitive ability.( 24 )

Clinicians should also pay attention to life event stressors, as these are associated with the onset of major depression, particularly in persons with a genetic predisposition.( 25 , 26 ) Such stressors include recent loss or bereavement, physical or emotional abuse, incidents involving humiliation, and difficult relationships.( 27 ) Since major depression often coexists with other psychiatric disorders (e.g. anxiety disorders, substance abuse and somatoform disorders),( 28 , 29 ) patients who present with these diagnoses should be screened for major depression, and vice versa. Box 1 shows a summary of risk factors for major depression.

Persons at risk of major depression include those with

How do I screen for major depression in primary care?

The Patient Health Questionaire-2 (PHQ-2; Table I ) is a two-item tool that can be used by primary care practitioners in the busy outpatient setting with a high patient load.( 34 ) Both items in PHQ-2 are listed as key criteria for the diagnosis of major depression in the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5).( 1 ) The specificity for major depression in primary care was as high as 90%, using a threshold score ≥ 3,( 34 ) but sensitivity findings were variable, ranging from 74% to 83%.( 34 , 35 ) Due to its brevity, the recommendation is to use the PHQ-2 simply as a screening tool for major depression and not for assessing disease severity. Among primary care doctors,( 35 ) some recommend using a threshold score ≥ 2 (instead of ≥ 3) to improve sensitivity. Patients who obtain a score ≥ 2 should proceed to the nine-item Patient Health Questionnaire-9 (PHQ-9).

Patient Health Questionnaire-2.( 34 )

The PHQ-9( 34 ) ( Table II ) exclusively focuses on the nine diagnostic criteria for major depression listed in the DSM-5.( 1 ) Major depression is diagnosed if a score ≥ 2 is obtained for five or more of the nine symptom criteria, with low mood or anhedonia being one of the criteria. For the criterion on suicide ideation (‘thoughts that you would be better off dead or of hurting yourself in some way’), a score ≥ 1 is counted, i.e. regardless of duration. The advantages of PHQ-9 are its brevity, sensitivity and specificity, and its utility as both a diagnostic and severity measure for major depression.

Patient Health Questionnaire-9.( 34 )

The Beck Depression Inventory (BDI)( 36 ) is a 21-item questionnaire that was first developed in 1961. The items cover affective, cognitive and somatic aspects of major depression. There were concerns that the somatic aspects of the inventory could lead to spuriously high estimates of major depression in patients with chronic medical conditions. A shorter version, the BDI-Fast Screen or BDI-FS (previously called BDI-Primary Care), was developed by removing the somatic components of the BDI. Each of the seven items (sadness, pessimism, past failure, anhedonia, self-dislike, self-criticalness and suicidal ideation) is rated on a four-point scale ranging from 0 to 3.( 37 ) A cutoff score ≥ 4 was found to be sensitive and specific for identifying major depression among outpatients.( 38 , 39 )

The Geriatric Depression Scale (GDS)( 40 ) is a 30-item depression questionnaire specifically designed for use in older adults. The GDS assesses the affective and cognitive aspects of major depression, but intentionally omits assessment for somatic symptoms. The rationale is that such an assessment may be non-discriminatory in the elderly due to the physiological effects of age and presence of chronic medical conditions. A score ≥ 11 on the GDS has a 84% sensitivity and 95% specificity for major depression in elderly patients.( 40 ) The questionnaire is easy to use, as the items require a yes-no response. However, the sheer number of items may be cumbersome in the busy outpatient setting. Shorter versions of the GDS, including 15-item, ten-item, four-item and one-item versions, have been found to be helpful in identifying depressive symptoms in elderly outpatients.( 41 )

Criteria and differentials for major depression

The primary care practitioner should be familiar with the criteria for the diagnosis of major depression, while being mindful of conditions that can mimic or coexist with major depression. An essential first step to management is making an accurate diagnosis.( 42 ) A meta-analysis has shown that, while primary care doctors are able to rule out major depression in persons who are not depressed, false positives are common in persons who are labelled as depressed.( 43 ) There is also reluctance to label patients as depressed even though they fulfil the diagnostic criteria. Underdiagnosing major depression leads to delay or non-treatment, while overdiagnosing it leads to antidepressant overuse, inappropriate referrals to psychiatric services and missing organic diseases that are mistaken as major depression.( 44 , 45 )

Major depression

The DSM-5 provides a set of criteria that should be fulfilled in order to diagnose major depression ( Box 2 ).( 1 ) The patient is said to have major depression if low mood or anhedonia (defined as loss of interest or pleasure) is present nearly every day for two or more weeks, together with other symptoms. However, it is important to note that the DSM-5, like any other diagnostic tool, serves as a guideline and should not replace clinical judgement. For example, a patient who presents with persistent low mood and anhedonia associated with hopelessness and suicidal ideation for ten days (hence not fulfilling the criteria of at least two weeks) should be managed in the same way as a patient with major depression. In the DSM-5 (which replaces the DSM-IV) criteria, recent bereavement is now recognised as one of the stressors that can precipitate major depression; it is thus not an exclusion criterion for the diagnosis of major depression.

DSM-5 criteria for major depressive episode( 1 )

The physician should also ensure that the symptoms of major depression are not attributable to another organic or psychiatric medical condition. Therefore, evaluation should take into consideration a number of organic illnesses that can mimic or coexist with major depression.( 46 ) The following conditions should be considered, as they determine both management and prognosis.

Persistent depressive disorder

Persistent depressive disorder (PDD) is characterised by milder depressive symptoms that persist for at least two years, or at least one year in children or adolescents.( 1 ) Patients should not be asymptomatic for more than two months. PDD can be underreported, as its symptoms are chronic and less severe, and form part of the patient’s regular day-to-day experience.( 1 ) Its symptoms are less likely to resolve compared to major depression,( 1 ) and may require a longer treatment period, more psychotherapy sessions, and/or higher doses of antidepressant medication. Psychotherapy may also be less effective for the treatment of PDD symptoms.( 47 )

Adjustment disorder with depressed mood

An adjustment disorder is an emotional response to a stressful event such as marital or relationship problems, loss of employment or acute illness.( 48 ) Patients can present with low mood, but this diagnosis is made only if the full criteria for a major depressive episode are not met.( 1 ) It can cause significant morbidity and increase suicide risk.

Bipolar disorder

Patients with bipolar disorder are often misdiagnosed as having unipolar major depression, particularly at initial presentation and in the primary care setting. A large proportion may remain misdiagnosed for up to ten years.( 49 , 50 ) There are various reasons for this. Patients with bipolar disorder are much more likely to present with low mood rather than mania or hypomania,( 51 , 52 ) and thus are labelled as having major depression. Hypomania in bipolar II disorder is often associated with increased creativity and energy with no impairment in function,( 53 ) which patients may not see as negative and often do not seek medical attention for. Misdiagnosis of bipolar disorder as major depression leads to inappropriate treatment with antidepressants instead of a mood stabiliser. As this contributes to worsening outcomes and may induce mania or rapid cycling,( 54 - 56 ) any patient who presents with symptoms of major depression should be evaluated for possible bipolar disorder.

A history of mania or hypomania is the main feature that distinguishes bipolar disorder from major depression. Manic episodes are present in bipolar I disorder, whereas the patient with bipolar II disorder experiences only hypomania and major depression without any manic episodes.( 1 ) Both mania and hypomania are characterised by an abnormally elevated or irritable mood, with persistent increased energy and a noticeable change from baseline behaviour. Behavioural changes may include a decreased need for sleep, an inflated self-esteem or grandiosity, increased goal-directed activity, being more talkative, and an excessive involvement in activities that are likely to have ill consequences, such as uncontrolled spending sprees, bad investments and sexual promiscuity.( 1 ) In mania, unlike hypomania, the patient’s symptoms are of at least a week’s duration and result in impaired functioning or require hospitalisation. Psychosis may or may not be present. It is important to check that the symptoms during these episodes are different, more prominent and more persistent as compared to the baseline.( 1 ) When taking a history, useful questions include: Have you ever experienced a period of time when you felt happier or more energetic than usual, for no particular reason? And if so, did you notice during such times that your thoughts were more rapid, or you had more ideas, required less sleep or were more talkative than usual? Did others notice this too? What did they say? How long did these last? Did they have any impact or effect on your life, work or relationships?

Other features that may help distinguish bipolar disorder from major depression include younger age of onset, a family history of bipolar disorder, a higher number of previous depressive episodes (e.g. too numerous to recall), atypical depressive features (e.g. hypersomnia instead of insomnia or hyperphagia instead of poor appetite), fewer somatic symptoms and increased phobias (e.g. of the dark, strangers or crowds).( 57 - 59 ) In patients who are misdiagnosed with major depression and started on antidepressants, rapid ‘switching’ from low mood to a manic or hypomanic state may occur.( 54 , 55 , 58 ) Hence, responding to antidepressant therapy too rapidly should raise the suspicion of a misdiagnosis as well.

Neurological conditions

Neurological conditions such as dementia, Parkinson’s disease and multiple sclerosis have symptoms that overlap with those of major depression.( 60 ) In Parkinson’s disease, low mood and other affective symptoms may even precede motor symptoms. Persons with cognitive impairment may present with low mood; conversely, those who have major depression may have poor concentration with impaired executive functioning and perform poorly at cognitive tests.( 23 , 61 ) Major depression itself may be a risk factor for developing dementia.( 61 , 62 ) Assessment should be guided by clinical suspicion. Neurological examination and cognitive assessment using well-known tools such as the Mini-Mental State Examination and Abbreviated Mental Test are important aspects of evaluation, particularly for older patients presenting with low mood.

Other organic conditions

In a person who presents predominantly with somatic symptoms, the primary care physician needs to first exclude any organic disease.( 21 , 31 ) Depending on the symptomatology, the scope of organic conditions to consider can be wide, especially with elderly patients. Organic conditions can also coexist or masquerade as major depression (e.g. occult malignancy or even infections).( 63 , 64 ) Patients should have their thyroid function tested, as thyroid dysfunction may present with low mood and other nonspecific somatic symptoms. However, minor abnormalities in thyroid function should be interpreted with caution; major depression may be associated with subtle changes in thyroid function.( 65 , 66 ) A useful method of differentiating major depression in medical patients, who may present with somatic symptoms similar to those found in major depression, is to ask about cognitive symptoms such as negative thinking, inappropriate guilt and low self-esteem.( 67 )

Drugs and substance abuse

Major depression is a risk factor for and is often associated with substance abuse, including that of alcohol,( 33 ) which may be under-recognised in elderly patients.( 68 , 69 ) In terms of lifetime prevalence, it has been shown that alcohol abuse is the second most common mental disorder among adults in Singapore.( 2 ) Tactful enquiry using an open-ended question about alcohol intake has been shown to enhance the sensitivity of the CAGE questionnaire.( 70 , 71 ) The patient’s medication history is important, as even prescription drugs have been cited as potential causes of major depression.( 72 ) A review found strong association between major depression and finasteride, isotretinoin and a smoking cessation drug, varenicline.( 73 ) The authors recommended that physicians exercise caution when prescribing these medications and strongly weigh risk-benefit considerations, particularly in persons who are predisposed to major depression.( 73 ) Fortunately, evidence implicating medications commonly prescribed in primary care was shown to be inconclusive. These medications include beta-blockers, calcium channel blockers, angiotensin-converting enzyme inhibitors and angiotensin II receptor blockers.( 73 )

Assessing the severity of major depression

The DSM-5( 1 ) defines the severity of major depression based on the number of criterion symptoms, severity of those symptoms and degree of functional disability. Major depression is classified as mild if (a) the patient has very few, if any, symptoms in excess of the five required to fulfil the criteria for diagnosis; (b) the symptoms are manageable; and (c) functional impairment is minor (e.g. the patient is still able to work). At the opposite end of the spectrum, severe major depression has (a) a substantially greater number of symptoms than that required to make the diagnosis; (b) seriously distressing and unmanageable symptoms; and (c) extensive impairment of social and occupational functioning. For moderate major depression, the number of symptoms, the intensity of symptoms and/or functional impairment are in-between those specified for ‘mild’ and ‘severe’.

The severity of major depression has an important bearing on the urgency and mode of treatment, setting in which the patient is to be managed and frequency of follow-up visits. For example, psychotherapy may be used as the first-line treatment for mild to moderate major depression, whereas pharmacotherapy is recommended for moderate to severe major depression.( 74 ) In patients with previous episodes of moderate to severe depression, who present with mild symptoms, the first-line treatment should be drug therapy.( 12 ) Those who have psychotic features should be managed by psychiatric services in tertiary care, while patients who are acutely suicidal should be hospitalised for urgent psychiatric evaluation.

Major depression is the most prevalent mental disorder in Singapore. Patients often present with somatic nonspecific complaints apart from the usual symptoms. Major depression is also common among patients with chronic conditions; there is a bidirectional relationship between the two factors. As the first point of contact for patients, the primary care practitioner is in a unique position to diagnose and manage major depression. Another important aspect of evaluating a person with major depression is performing a suicide risk assessment, which is described in our next article in this three-part series.

You identified the death of Susan’s cousin as a life event that had a significant emotional impact on her. Using the PHQ-2 and PHQ-9, you diagnosed Susan with major depression. You started her on a serotonin-specific reuptake inhibitor and referred her to a clinical psychologist for cognitive behaviour therapy .

TAKE HOME MESSAGES

• Major depression is the most common mental disorder in the community and patients often present with somatic symptoms.
• Major depression is potentially a chronic illness that has considerable morbidity, and high relapse and recurrence rates.
• There is a bidirectional relationship between major depression and chronic diseases.
• Clinical tools available for screening for major depression include the common PHQ-2, PHQ-9 and BDI.
• The severity of major depression, according to the DSM-5, increases with the number of criterion symptoms present and degree of functional disability.

• Bipolar Disorder
• Therapy Center
• When To See a Therapist
• Types of Therapy
• Best Online Therapy
• Best Couples Therapy
• Best Family Therapy
• Managing Stress
• Sleep and Dreaming
• Understanding Emotions
• Self-Improvement
• Healthy Relationships
• Student Resources
• Personality Types
• Guided Meditations
• Verywell Mind Insights
• 2024 Verywell Mind 25
• Mental Health in the Classroom
• Editorial Process
• Meet Our Review Board
• Crisis Support

Major Depressive Disorder: Symptoms, Causes, and Treatment

Sanjana is a health writer and editor. Her work spans various health-related topics, including mental health, fitness, nutrition, and wellness.

Dr. Sabrina Romanoff, PsyD, is a licensed clinical psychologist and a professor at Yeshiva University’s clinical psychology doctoral program.

Tony Anderson / Getty Images

Depression , also referred to as clinical depression or major depressive disorder, is a medical condition that is classified as a mood disorder. It can affect how you feel and your ability to function on a day-to-day basis.

While everyone tends to feel sad or low from time to time, feeling that way for weeks or months at a time could mean you have depression.

If you suspect you may have depression, you’re not alone. Over 8% of adults living in the United States have experienced at least one major depressive episode.

At a Glance

Major depressive disorder is marked by symptoms such as sadness, loss of interest in previously enjoyed activities, difficulty concentrating, and changes in sleep and appetite. Causes include brain chemistry, genetics, and environmental factors. There are treatments available that can help, including therapy, medication, and lifestyle changes.

Symptoms of Major Depressive Disorder

Everyone experiences depression differently. While some people may have a few symptoms, others may have many. The frequency, severity, and duration of the symptoms can also vary from person to person.

These are some of the symptoms of major depressive disorder you may experience:

• Feeling sad or low
• Having an "empty" mood
• Feeling anxious
• Feeling guilty or helpless
• Feeling worthless, hopeless, or pessimistic
• Feeling restless, frustrated, or irritated
• Losing interest in things you once enjoyed
• Avoiding your usual activities
• Having less energy and feeling fatigued
• Moving or speaking slowly
• Having difficulty paying attention, remembering, or making decisions 
• Having difficulty sleeping, waking up too early, or oversleeping
• Experiencing unplanned changes in eating habits and weight
• Experiencing headaches, cramps, digestive issues, or other aches and pains that don’t have a clear cause and don’t get better with treatment
• Talking about death, having thoughts of suicide , or attempting self-harm

If you are having suicidal thoughts, contact the National Suicide Prevention Lifeline at 988 for support and assistance from a trained counselor. If you or a loved one are in immediate danger, call 911.

For more mental health resources, see our National Helpline Database .

Types of Depression

Depression may take different forms, or develop under certain circumstances. Accordingly, it may be classified into different types of depression , one of which is major depressive disorder.

The types of depression include:

• Major depressive disorder: This is a form of depression where the person experiences symptoms for over two weeks. The symptoms affect their ability to eat, sleep, work, and function.
• Persistent depressive disorder: Also known as dysthymia , this is a form of depression that lasts for over two years.
• Perinatal depression: This is a form of depression people experience during pregnancy (known as antepartum depression ) and after pregnancy (known as postpartum depression ).
• Premenstrual dysphoric disorder (PMDD): PMDD is a severe, disabling form of premenstrual syndrome (PMS) that can cause extreme mood swings.
• Depression with psychotic features: A person may have psychotic depression if they have depression as well as psychosis, which is a condition that can make it hard to distinguish between what’s real and what isn’t.
• Seasonal affective disorder (SAD): This is a form of depression that occurs in winter , when there is less natural sunlight.
• Bipolar disorder: While bipolar disorder is not technically a type of depression, it can cause periods of low moods with similar symptoms to major depression.

Causes of Major Depressive Disorder

The exact causes of major depressive disorder are not fully understood, but experts believe that several different factors cause it. Some factors that may contribute to the onset of major depressive disorder include genetics, stress, certain medical conditions, and brain chemistry.

Certain genetic, biological, psychological, and environmental factors can increase the chances of someone developing depression; however, it’s important to remember that anyone can develop depression.

The potential causes and risk factors for depression include:

Biochemistry

Having differences in the levels of certain brain chemicals can make you more prone to developing depression. The most recent evidence indicates that chemical imbalances in the brain are not the primary cause of depression. Neurotransmitters like serotonin and dopamine do play an important role in mood, which is why antidepressant medications that affect neurotransmitter levels may be helpful.

Genetic Factors

Genes can play a role in depression. Having a relative with depression can increase your chances of developing depression.

Having a genetic risk for depression does not necessarily mean that you will develop the condition. Instead, it is believed that the interaction of genetic and environmental factors is what determines if someone experiences depression.

If you have a close relative with depression (such as a parent, sibling, or child), your risk of also developing the condition is around three times higher than that of the general population.

Personal Medical History

You may be more likely to develop depression if you have had it before. One of the best predictors of whether you will experience depression in the future is whether you've experienced it in the past.

Research suggests that around 70% of people who've had two episodes of major depressive disorder in the past will have a recurring episode in the future.

Women may be twice as likely to develop depression than men. Factors contributing to this increased risk include hormonal differences, socialization differences, and greater life stress.

Life Events

Trauma , the death of a loved one, major life changes, and other upsetting events can cause depression. People who experience trauma in childhood have a higher risk of developing depression as adults.

Stress can affect you physically and mentally, and increase your risk of developing depression.

Lack of support and social isolation can increase the chances of developing depression. Unfortunately, social withdrawal is a common symptom of depression.

Medical Conditions

Depression may occur along with chronic or serious medical conditions like cancer, heart disease, diabetes, and Parkinson’s disease. Having depression can worsen these conditions.

Some medicines can cause depression as a side effect. Some medications that can have depression as a side effect include:

• Anticonvulsants
• Antidepressants
• Corticosteroids
• Hormonal contraceptives
• Parkinson's medications
• Proton pump inhibitors

Substances such as alcohol or drugs can cause or exacerbate depression. Unfortunately, it is not uncommon for people who feel depressed to use alcohol or substances as a way to cope. However, alcohol can affect the brain in ways that worsen depression .

Personality

People who have difficulty coping with various life events may be more prone to developing depression. People who are low in extraversion and high in neuroticism have a higher risk of developing depression.

Diagnosing Major Depressive Disorder

If you or a loved one have been feeling depressed and low, seek help as soon as possible. You can reach out to a mental healthcare provider or contact your primary care doctor for a diagnosis or referral.

Your healthcare provider will ask you a series of questions that will likely cover your symptoms , thoughts and feelings, and medical history. They may need to perform a physical or psychological exam, or conduct lab tests, in order to rule out other health conditions that can cause similar symptoms.

Your healthcare provider will determine whether or not your symptoms meet the diagnostic criteria for major depressive disorder, which include:

• Having a persistently depressed mood and lack of interest in activities
• Having five or more symptoms of depression
• Having symptoms every day, almost all day
• Having symptoms for over two weeks
• Being unable to function like you did before, due to the symptoms

Treating Major Depressive Disorder

While depression is a serious condition, it can be treated. In fact, between 80% to 90% of people with depression respond well to treatment, and almost all patients get some relief from their symptoms.

It’s important to seek treatment for depression as soon as possible, because the earlier it is treated, the more effective the treatment can be. Ignoring the symptoms of depression and leaving it untreated can lead to self-harm or death.

Treatment for depression may involve medication, therapy, or brain stimulation. The treatment modalities chosen can depend on the severity of the depression and your individual needs.

Antidepressants are a type of medication that can help treat depression. They work by improving the balance of neurotransmitters in the brain. They are typically prescribed to treat moderate or severe cases of depression.

There are many different kinds of antidepressants, so you may need to try a few different types before you find the one that works best for you.

However, it’s important to note that antidepressants can take a few weeks or months to improve your mood, so you need to give the medication time to reach its full effect.

Psychotherapy , or talk therapy, can help treat depression. For mild cases of depression, your healthcare provider may recommend only psychotherapy, whereas for moderate to severe cases, a combination of medication and therapy may be recommended.

These are some of the types of therapy that can help treat depression:

• Cognitive behavioral therapy (CBT): CBT can help you recognize unhelpful thought patterns contributing to depression. It can help you develop more positive thoughts and behaviors.
• Psychodynamic therapy: Psychodynamic therapy can help you explore and understand how factors from your past, such as traumatic events, may have played a role in the development of depression.
• Group therapy: This type of therapy is conducted in a group setting, rather than an individual setting. It can be helpful to interact with people who have similar experiences in a supportive environment.
• Couples or family therapy: Family therapy can help address issues within the family, whereas couples therapy can help partners work through issues together.

You should expect to start feeling better after the first 10 to 15 sessions of therapy. The length of treatment can vary depending on how severe the depression is.

Brain Stimulation

Certain medical procedures known as brain stimulation therapies can help with severe cases of depression that aren’t responding to medication or therapy. The different types of brain stimulation include:

• Electroconvulsive therapy (ECT): ECT involves electrical stimulation of the brain. The procedure is painless and you won't be able to feel the electrical impulses, but you will need to take a muscle relaxant and undergo brief anesthesia before each session.
• Repetitive transcranial magnetic stimulation (rTMS): rTMS is a noninvasive procedure that involves placing an electromagnetic coil near your forehead. The coil delivers a magnetic pulse that stimulates nerve cells in the brain. rTMS is performed on an outpatient basis and doesn’t require anesthesia.
• Vagus nerve stimulation (VNS): VNS involves implanting a device that sends pulses of electric energy to the brain, through the vagus nerve in the neck. You can think of it as a pacemaker for your brain. The device is inserted during a surgical procedure that may require an overnight stay in a hospital.

Coping With Major Depressive Disorder

These are some tips that can help you cope with depression :

• Share your feelings with close friends and family members
• Understand that recovery may be gradual, so set realistic goals for yourself
• Postpone important decisions until you feel better
• Stay active and exercise regularly
• Maintain a consistent routine
• Get enough sleep
• Eat a balanced, nutritious diet
• Avoid alcohol, nicotine, drugs , and medicines that have not been prescribed to you

Major depressive order, a type of depression, is a serious medical condition that is caused by a chemical imbalance in the brain. It is neither a character flaw nor a weakness, and can happen to anyone.

If you or someone you know are experiencing depression , it’s important to seek treatment for it . Treatment can reduce the symptoms, help you cope, and enable you to function on a day-to-day basis.

National Institute of Mental Health. Depression .

National Institute of Mental Health. Major depression .

National Institute of Aging. Depression and older adults .

Otte C, Gold SM, Penninx BW, et al. Major depressive disorder . Nat Rev Dis Primers . 2016;2:16065. doi:10.1038/nrdp.2016.65

Moncrieff J, Cooper RE, Stockmann T, Amendola S, Hengartner MP, Horowitz MA.  The serotonin theory of depression: A systematic umbrella review of the evidence .  Mol Psychiatry . 2022. doi:10.1038/s41380-022-01661-0

Kwong ASF, López-López JA, Hammerton G, et al.  Genetic and environmental risk factors associated with trajectories of depression symptoms from adolescence to young adulthood .  JAMA Netw Open.  2019;2(6):e196587. doi:10.1001/jamanetworkopen.2019.6587

Dunn EC, Brown RC, Dai Y, et al.  Genetic determinants of depression: recent findings and future directions .  Harv Rev Psychiatry . 2015;23(1):1-18. doi:10.1097/HRP.0000000000000054

Lye MS, Tey YY, Tor YS, et al. Predictors of recurrence of major depressive disorder .  PLoS One . 2020;15(3):e0230363. doi:10.1371/journal.pone.0230363

Kupfer DJ, Frank E, Phillips ML. Major depressive disorder: new clinical, neurobiological, and treatment perspectives . Lancet . 2012;379(9820):1045-1055. doi:10.1016/S0140-6736(11)60602-8

Ebert DD, Buntrock C, Mortier P, et al. Prediction of major depressive disorder onset in college students . Depress Anxiety . 2019;36(4):294-304. doi:10.1002/da.22867

Yang L, Zhao Y, Wang Y, et al. The effects of psychological stress on depression . Curr Neuropharmacol . 2015;13(4):494-504. doi:10.2174/1570159X1304150831150507

Rosenblat JD, Kurdyak P, Cosci F, et al. Depression in the medically ill . Aust N Z J Psychiatry. 2020;54(4):346-366. doi:10.1177/0004867419888576

Yu T, Hu J. Extraversion and neuroticism on college freshmen's depressive symptoms during the COVID-19 pandemic: The mediating role of social support .  Front Psychiatry . 2022;13:822699. doi:10.3389/fpsyt.2022.822699

American Psychiatric Association. What is depression?

Mount Sinai. Depression .

Johns Hopkins Medicine. Major depression .

Xie Y, Wu Z, Sun L, et al. The effects and Mechanisms of Exercise on the Treatment of Depression .  Front Psychiatry . 2021;12:705559. doi:10.3389/fpsyt.2021.705559

Cleveland Clinic. Depression .

National Library of Medicine. Depression . Medline Plus .

By Sanjana Gupta Sanjana is a health writer and editor. Her work spans various health-related topics, including mental health, fitness, nutrition, and wellness.